Mutagenetix > Incidental Mutation

Incidental Mutation 'R9683:Acr'

728711

Institutional Source

Beutler Lab

Gene Symbol

Acr

Ensembl Gene

ENSMUSG00000022622

Gene Name

acrosin prepropeptide

Synonyms

preproacrosin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R9683 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89568326-89574585 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 89573237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 229 (Y229*)

Ref Sequence

ENSEMBL: ENSMUSP00000023295 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023295]

AlphaFold

P23578

Predicted Effect

probably null
Transcript: ENSMUST00000023295
AA Change: Y229*

SMART Domains

Protein: ENSMUSP00000023295
Gene: ENSMUSG00000022622
AA Change: Y229*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Tryp_SPc	42	286	6.84e-91	SMART
low complexity region	300	311	N/A	INTRINSIC
low complexity region	329	364	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000230538
AA Change: Y181*

Predicted Effect

probably null
Transcript: ENSMUST00000230978
AA Change: Y192*

Predicted Effect

probably benign
Transcript: ENSMUST00000231216

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for a targeted null mutation produce sperm that shows delayed fertilization in vitro. Sperm from mutant gonial cells are ineffective at fertilization in competition with normal sperm both in vitro and in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	C	T	3: 124,406,446	G499D	probably benign	Het
Adam6b	G	T	12: 113,490,556	C331F	probably benign	Het
Ahnak	T	C	19: 9,007,355	V2001A	possibly damaging	Het
Ankrd11	C	T	8: 122,890,943	A2057T	probably benign	Het
Anln	A	T	9: 22,372,240	C432*	probably null	Het
Aox4	T	C	1: 58,239,303		probably null	Het
Astn1	A	G	1: 158,664,049	I1007V	possibly damaging	Het
Bicral	T	C	17: 46,812,018	D649G	possibly damaging	Het
C1qbp	G	A	11: 70,982,923	R10C	probably damaging	Het
Cass4	C	T	2: 172,426,736	P246L	probably damaging	Het
Celsr3	T	A	9: 108,827,323	V335E	probably damaging	Het
Cfap52	T	A	11: 67,931,813	T411S	probably benign	Het
Cnot6	A	T	11: 49,689,337	L43I	possibly damaging	Het
Col9a3	G	A	2: 180,606,529		probably null	Het
Dnah14	A	G	1: 181,598,944	R210G	probably benign	Het
Fat4	A	G	3: 38,889,183	S742G	possibly damaging	Het
Fbn2	C	T	18: 58,053,027	V1750M	probably benign	Het
Glrx2	A	G	1: 143,746,554	D96G	probably damaging	Het
Gm8369	T	C	19: 11,511,733	L128P	probably damaging	Het
Gpr155	A	G	2: 73,362,436	I585T	probably benign	Het
Heatr1	T	C	13: 12,434,259	S1907P	probably damaging	Het
Hscb	T	C	5: 110,836,015	T129A	possibly damaging	Het
Itgb5	T	A	16: 33,919,965	Y482N	probably damaging	Het
Kmt5b	T	A	19: 3,815,587	*884R	probably null	Het
L3mbtl1	A	T	2: 162,970,308	T758S	possibly damaging	Het
Mindy1	A	T	3: 95,294,865	H351L	probably benign	Het
Mmel1	A	T	4: 154,892,828	I552F	probably damaging	Het
Mos	T	C	4: 3,871,186	D210G	probably benign	Het
Npl	A	C	1: 153,545,284	I16S	possibly damaging	Het
Nutm2	C	A	13: 50,474,981	P694T	possibly damaging	Het
Olfr376	G	A	11: 73,374,985	V82I	probably damaging	Het
Olfr608	A	G	7: 103,469,950		probably benign	Het
Plekhg4	T	C	8: 105,376,291	F261L	probably benign	Het
Ppfia3	T	A	7: 45,356,575	N331I	probably benign	Het
Ppp1r12a	T	A	10: 108,260,886	S712R	possibly damaging	Het
Psg20	T	A	7: 18,682,583	K203*	probably null	Het
Recql	C	T	6: 142,359,920	R234Q		Het
Rerg	A	G	6: 137,056,254	F160S	probably damaging	Het
Rp1l1	A	G	14: 64,031,677	K1571E	probably damaging	Het
Rsrc1	T	A	3: 67,349,995	S247T	probably damaging	Het
Sacs	T	A	14: 61,213,432	I4309N	possibly damaging	Het
Setd7	A	T	3: 51,542,690	I105N	possibly damaging	Het
Sgk1	AAGA	AAGAGA	10: 21,992,391		probably null	Het
Siglec1	T	A	2: 131,079,316	H645L	probably damaging	Het
Slain1	A	T	14: 103,688,185	D323V	probably damaging	Het
Slc25a10	A	G	11: 120,495,486	N139D	probably damaging	Het
Slc9a9	T	G	9: 94,670,182	F41V	probably damaging	Het
Spag9	A	C	11: 94,097,742	E879D	probably damaging	Het
Tdrd7	T	A	4: 46,025,946	L922Q	probably damaging	Het
Tiprl	A	G	1: 165,222,578	F156S	probably damaging	Het
Tmem185b	G	C	1: 119,527,018	V170L	probably damaging	Het
Top2a	G	A	11: 98,996,857	T1275I	probably benign	Het
Tpp1	A	G	7: 105,748,897	L353P	probably damaging	Het
Twnk	T	A	19: 45,010,183	H513Q	probably damaging	Het
Ubr5	C	T	15: 37,978,027	V2467I		Het
Vmn2r16	T	A	5: 109,363,811	I628N	probably damaging	Het
Zan	T	C	5: 137,464,514	E801G	unknown	Het
Zfp810	T	C	9: 22,278,503	R370G	possibly damaging	Het
Zfp955a	A	G	17: 33,242,613	S182P	probably benign	Het
Znrf3	T	C	11: 5,444,465	T72A	possibly damaging	Het

Other mutations in Acr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Acr	APN	15	89573250	missense	probably benign	0.19
IGL00857:Acr	APN	15	89570002	missense	probably benign	0.00
IGL01353:Acr	APN	15	89569492	missense	probably damaging	1.00
IGL01466:Acr	APN	15	89573994	missense	probably benign
IGL01599:Acr	APN	15	89568414	missense	probably benign	0.01
IGL02408:Acr	APN	15	89570014	missense	probably damaging	1.00
R0042:Acr	UTSW	15	89574332	missense	probably benign
R0398:Acr	UTSW	15	89573941	missense	probably damaging	1.00
R0520:Acr	UTSW	15	89573227	missense	probably damaging	1.00
R0578:Acr	UTSW	15	89569475	missense	probably damaging	1.00
R0579:Acr	UTSW	15	89569475	missense	probably damaging	1.00
R1167:Acr	UTSW	15	89573974	missense	probably damaging	1.00
R1792:Acr	UTSW	15	89573143	missense	probably benign	0.00
R2006:Acr	UTSW	15	89574201	missense	probably benign	0.00
R5531:Acr	UTSW	15	89573943	missense	probably damaging	1.00
R5577:Acr	UTSW	15	89574238	missense	probably benign	0.01
R7033:Acr	UTSW	15	89569500	missense	probably benign	0.03
R7206:Acr	UTSW	15	89574171	missense	probably benign
R7484:Acr	UTSW	15	89573224	missense	probably damaging	0.99
R7548:Acr	UTSW	15	89574393	missense	possibly damaging	0.72
R8001:Acr	UTSW	15	89573962	missense	probably damaging	1.00
R8325:Acr	UTSW	15	89569751	missense	probably benign	0.22
R8852:Acr	UTSW	15	89573854	missense	probably damaging	1.00
R8860:Acr	UTSW	15	89573854	missense	probably damaging	1.00
Z1177:Acr	UTSW	15	89569879	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TTAACCAGAGCGCTGCATAGG -3'
(R):5'- GGTACCAGGGAACAAGTCAC -3'

Sequencing Primer
(F):5'- CTGCATAGGATGGATGGAAGCTC -3'
(R):5'- CAAGTCACTGGAGTTGCTGGC -3'

Posted On

2022-10-06