Incidental Mutation 'R0843:Cenpn'
ID77254
Institutional Source Beutler Lab
Gene Symbol Cenpn
Ensembl Gene ENSMUSG00000031756
Gene Namecentromere protein N
Synonyms2610510J17Rik
MMRRC Submission 039022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R0843 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location116921730-116941507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116933306 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 125 (V125A)
Ref Sequence ENSEMBL: ENSMUSP00000034205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034205] [ENSMUST00000212263] [ENSMUST00000212775]
Predicted Effect probably benign
Transcript: ENSMUST00000034205
AA Change: V125A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034205
Gene: ENSMUSG00000031756
AA Change: V125A

DomainStartEndE-ValueType
Pfam:CENP-N 3 337 3.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212184
Predicted Effect probably benign
Transcript: ENSMUST00000212263
AA Change: V38A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000212775
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,071 R228G probably benign Het
Arrdc3 T C 13: 80,890,803 probably benign Het
Cacna1d T C 14: 30,124,871 Y526C probably damaging Het
Cyfip1 A T 7: 55,922,820 H963L probably benign Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
Dnmt3a T C 12: 3,872,886 probably benign Het
Dync1h1 C T 12: 110,665,213 T4448M possibly damaging Het
Efr3a T A 15: 65,837,423 probably benign Het
Fam46b T C 4: 133,486,531 S238P probably damaging Het
Fgf11 T G 11: 69,798,776 probably benign Het
Gabrr1 T A 4: 33,161,717 I347N possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hspa1b T A 17: 34,957,548 N487I possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Iqgap3 A G 3: 88,108,431 D40G possibly damaging Het
Iyd T C 10: 3,545,663 V107A possibly damaging Het
Kctd3 A T 1: 188,996,973 L129* probably null Het
Myo7b A G 18: 31,974,084 F1286S possibly damaging Het
Olfr1256 C T 2: 89,835,616 V110I probably benign Het
Olfr591 T A 7: 103,173,119 T173S possibly damaging Het
Olfr893 T A 9: 38,209,283 F77I possibly damaging Het
Pcsk5 T A 19: 17,654,818 Y328F probably damaging Het
Plxnb1 T C 9: 109,113,701 L1810P probably benign Het
Polr2h T A 16: 20,718,899 V50E probably damaging Het
Ppm1g T C 5: 31,207,551 probably benign Het
Ptpru T A 4: 131,797,948 R741S probably benign Het
Pyroxd2 T C 19: 42,747,547 E64G probably damaging Het
Rad54b T C 4: 11,609,471 probably null Het
Rangap1 A T 15: 81,710,502 D375E probably benign Het
Rhbdf1 G A 11: 32,215,053 R107C probably damaging Het
Scaf11 T C 15: 96,431,825 E140G probably damaging Het
Slitrk6 G T 14: 110,750,098 H726N probably benign Het
Spry2 A G 14: 105,893,090 C221R probably damaging Het
Stx2 C T 5: 128,999,548 V24M probably damaging Het
Tll2 T A 19: 41,128,463 probably null Het
Ttyh3 C A 5: 140,626,446 probably null Het
Vmn2r116 T C 17: 23,400,960 V556A probably benign Het
Xpo5 T C 17: 46,222,650 probably benign Het
Zc3h3 A G 15: 75,837,479 S514P probably benign Het
Zfp277 A C 12: 40,320,600 probably null Het
Other mutations in Cenpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Cenpn APN 8 116928587 splice site probably null
IGL02084:Cenpn APN 8 116940895 missense probably damaging 1.00
R0791:Cenpn UTSW 8 116940820 splice site probably benign
R1166:Cenpn UTSW 8 116926207 missense probably damaging 1.00
R1650:Cenpn UTSW 8 116934759 missense probably damaging 1.00
R2132:Cenpn UTSW 8 116934797 critical splice donor site probably null
R4512:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4513:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4514:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4865:Cenpn UTSW 8 116934773 missense probably damaging 1.00
R5969:Cenpn UTSW 8 116940537 missense probably damaging 1.00
R6518:Cenpn UTSW 8 116937165 missense possibly damaging 0.88
R6795:Cenpn UTSW 8 116926148 missense probably benign 0.02
R7143:Cenpn UTSW 8 116937227 missense probably benign 0.00
R7556:Cenpn UTSW 8 116937269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCATGTGTCTTGTGGCAATG -3'
(R):5'- GACGGAGAAACGCTCTCCTTAGAAC -3'

Sequencing Primer
(F):5'- AAAAGACTGACAGGTGCCCA -3'
(R):5'- CTCTCCTTAGAACGGGAGGTAG -3'
Posted On2013-10-16