Incidental Mutation 'R4514:Cenpn'
ID332803
Institutional Source Beutler Lab
Gene Symbol Cenpn
Ensembl Gene ENSMUSG00000031756
Gene Namecentromere protein N
Synonyms2610510J17Rik
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location116921730-116941507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116933396 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 68 (Y68C)
Ref Sequence ENSEMBL: ENSMUSP00000148413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034205] [ENSMUST00000212263] [ENSMUST00000212775]
Predicted Effect probably damaging
Transcript: ENSMUST00000034205
AA Change: Y155C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034205
Gene: ENSMUSG00000031756
AA Change: Y155C

DomainStartEndE-ValueType
Pfam:CENP-N 3 337 3.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212184
Predicted Effect probably damaging
Transcript: ENSMUST00000212263
AA Change: Y68C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000212775
Meta Mutation Damage Score 0.8846 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Cenpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Cenpn APN 8 116928587 splice site probably null
IGL02084:Cenpn APN 8 116940895 missense probably damaging 1.00
R0791:Cenpn UTSW 8 116940820 splice site probably benign
R0843:Cenpn UTSW 8 116933306 missense probably benign 0.09
R1166:Cenpn UTSW 8 116926207 missense probably damaging 1.00
R1650:Cenpn UTSW 8 116934759 missense probably damaging 1.00
R2132:Cenpn UTSW 8 116934797 critical splice donor site probably null
R4512:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4513:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4865:Cenpn UTSW 8 116934773 missense probably damaging 1.00
R5969:Cenpn UTSW 8 116940537 missense probably damaging 1.00
R6518:Cenpn UTSW 8 116937165 missense possibly damaging 0.88
R6795:Cenpn UTSW 8 116926148 missense probably benign 0.02
R7143:Cenpn UTSW 8 116937227 missense probably benign 0.00
R7556:Cenpn UTSW 8 116937269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTGCCCACAATGCATG -3'
(R):5'- TATCTTCTGTCACATAGCCGAC -3'

Sequencing Primer
(F):5'- AACATTGATTGTGTCTCAGATGCCC -3'
(R):5'- TAGCCGACGGAGAAACGCTC -3'
Posted On2015-08-18