Incidental Mutation 'R0963:Wdr75'
ID81336
Institutional Source Beutler Lab
Gene Symbol Wdr75
Ensembl Gene ENSMUSG00000025995
Gene NameWD repeat domain 75
Synonyms2410118I19Rik, 1300003A18Rik
MMRRC Submission 039092-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R0963 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location45795166-45823619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45817310 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 498 (Y498H)
Ref Sequence ENSEMBL: ENSMUSP00000027139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027139]
Predicted Effect probably benign
Transcript: ENSMUST00000027139
AA Change: Y498H

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027139
Gene: ENSMUSG00000025995
AA Change: Y498H

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
WD40 185 230 1.61e-3 SMART
WD40 239 275 4.44e0 SMART
WD40 278 317 7.67e0 SMART
low complexity region 405 417 N/A INTRINSIC
WD40 431 473 7.67e0 SMART
WD40 486 524 3.08e0 SMART
WD40 527 568 3.96e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186308
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025F22Rik T C 19: 11,141,557 T63A possibly damaging Het
Adarb2 A G 13: 8,672,415 D369G probably damaging Het
Adcy7 T C 8: 88,312,265 V303A probably damaging Het
Afap1l1 A T 18: 61,736,930 Y610N probably damaging Het
Agr3 T A 12: 35,934,434 H53Q probably benign Het
Akr1d1 A G 6: 37,530,274 I10M probably damaging Het
Atp4b G T 8: 13,390,014 H111N probably benign Het
Bbs7 G T 3: 36,613,263 A8E probably benign Het
Bsn C T 9: 108,111,807 V2249M possibly damaging Het
Cpt1a T C 19: 3,381,634 S685P probably damaging Het
Dhx57 A T 17: 80,275,527 H163Q probably benign Het
Duox2 A C 2: 122,287,172 C894G probably benign Het
Ecm1 T C 3: 95,736,588 T209A possibly damaging Het
Glo1 T C 17: 30,600,111 N79S probably benign Het
Gm13078 T A 4: 143,727,108 I262N possibly damaging Het
Gm4763 A T 7: 24,723,622 D90E probably benign Het
Htra1 T A 7: 130,982,279 M388K possibly damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Jag2 C T 12: 112,915,314 E496K probably damaging Het
Kcnh2 C T 5: 24,322,672 R894H probably damaging Het
Khdc1c A G 1: 21,369,609 N128S probably benign Het
Lamc1 T C 1: 153,243,386 N829S probably benign Het
Leprotl1 T C 8: 34,139,035 Y33C probably damaging Het
Map3k3 T A 11: 106,123,792 S130T probably benign Het
Mip C T 10: 128,225,985 A35V probably benign Het
Myh15 A G 16: 49,132,149 R861G probably damaging Het
Myom1 A C 17: 71,077,767 I718L possibly damaging Het
Naip6 C T 13: 100,316,475 R26H probably benign Het
Olfr677 G A 7: 105,056,972 C242Y probably damaging Het
Pde6b A G 5: 108,430,668 E824G probably benign Het
Rbm19 T G 5: 120,130,734 S476A possibly damaging Het
Rpl39l T A 16: 10,174,298 probably null Het
Sec24b A G 3: 130,040,905 S79P probably benign Het
Slc15a2 G A 16: 36,774,573 A146V probably damaging Het
Slmap T C 14: 26,468,520 Y161C probably damaging Het
Smc4 T A 3: 69,025,926 C652S probably damaging Het
Stab1 A G 14: 31,147,274 I1499T probably damaging Het
Tnnt1 A G 7: 4,507,595 L209P probably damaging Het
Trim52 T G 14: 106,107,539 S210R probably benign Het
Tsc22d1 T A 14: 76,418,599 N82K possibly damaging Het
Zfp955a C T 17: 33,243,752 S56N probably benign Het
Other mutations in Wdr75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Wdr75 APN 1 45802075 missense probably benign 0.02
IGL00711:Wdr75 APN 1 45823381 missense probably benign 0.00
IGL01350:Wdr75 APN 1 45818260 nonsense probably null
IGL02135:Wdr75 APN 1 45814563 missense probably damaging 1.00
IGL02135:Wdr75 APN 1 45817448 splice site probably null
FR4976:Wdr75 UTSW 1 45823404 utr 3 prime probably benign
PIT4378001:Wdr75 UTSW 1 45820173 missense probably damaging 0.98
R0060:Wdr75 UTSW 1 45816617 missense probably benign 0.16
R0463:Wdr75 UTSW 1 45819602 missense probably damaging 1.00
R1364:Wdr75 UTSW 1 45799062 missense probably benign 0.01
R1382:Wdr75 UTSW 1 45817311 missense probably damaging 1.00
R1562:Wdr75 UTSW 1 45803870 splice site probably null
R1909:Wdr75 UTSW 1 45823403 missense probably benign 0.00
R2968:Wdr75 UTSW 1 45817341 missense probably damaging 1.00
R3972:Wdr75 UTSW 1 45822554 missense probably benign 0.01
R4372:Wdr75 UTSW 1 45806673 unclassified probably benign
R4720:Wdr75 UTSW 1 45822485 missense probably benign 0.05
R4922:Wdr75 UTSW 1 45816478 missense probably damaging 1.00
R5201:Wdr75 UTSW 1 45823359 missense probably benign 0.00
R5242:Wdr75 UTSW 1 45817327 nonsense probably null
R5255:Wdr75 UTSW 1 45799117 missense probably damaging 1.00
R5320:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R5450:Wdr75 UTSW 1 45812164 missense probably benign 0.26
R6072:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R6147:Wdr75 UTSW 1 45819538 missense probably benign 0.00
R6341:Wdr75 UTSW 1 45802131 critical splice donor site probably null
R6629:Wdr75 UTSW 1 45812056 missense probably damaging 1.00
R6646:Wdr75 UTSW 1 45799087 missense probably damaging 1.00
R6722:Wdr75 UTSW 1 45805352 intron probably null
R6750:Wdr75 UTSW 1 45817379 missense probably damaging 1.00
R6850:Wdr75 UTSW 1 45814598 missense probably benign 0.00
R6851:Wdr75 UTSW 1 45823427 missense probably benign
R7172:Wdr75 UTSW 1 45799134 missense probably damaging 1.00
R7248:Wdr75 UTSW 1 45817400 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCATAAAGGGTTCCTGCC -3'
(R):5'- AACTCACGGGTTACAGCTTCTCAAC -3'

Sequencing Primer
(F):5'- TTCTCCTCCACTAGAGGGAGC -3'
(R):5'- GGGTTACAGCTTCTCAACATTTTG -3'
Posted On2013-11-07