Incidental Mutation 'R5255:Wdr75'
ID399435
Institutional Source Beutler Lab
Gene Symbol Wdr75
Ensembl Gene ENSMUSG00000025995
Gene NameWD repeat domain 75
Synonyms2410118I19Rik, 1300003A18Rik
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location45795166-45823619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45799117 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 62 (I62N)
Ref Sequence ENSEMBL: ENSMUSP00000117363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027139] [ENSMUST00000147308]
Predicted Effect probably damaging
Transcript: ENSMUST00000027139
AA Change: I62N

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027139
Gene: ENSMUSG00000025995
AA Change: I62N

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
WD40 185 230 1.61e-3 SMART
WD40 239 275 4.44e0 SMART
WD40 278 317 7.67e0 SMART
low complexity region 405 417 N/A INTRINSIC
WD40 431 473 7.67e0 SMART
WD40 486 524 3.08e0 SMART
WD40 527 568 3.96e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146602
Predicted Effect probably damaging
Transcript: ENSMUST00000147308
AA Change: I62N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117363
Gene: ENSMUSG00000025995
AA Change: I62N

DomainStartEndE-ValueType
WD40 4 42 3.82e1 SMART
WD40 45 85 1.25e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154436
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Wdr75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Wdr75 APN 1 45802075 missense probably benign 0.02
IGL00711:Wdr75 APN 1 45823381 missense probably benign 0.00
IGL01350:Wdr75 APN 1 45818260 nonsense probably null
IGL02135:Wdr75 APN 1 45814563 missense probably damaging 1.00
IGL02135:Wdr75 APN 1 45817448 splice site probably null
FR4976:Wdr75 UTSW 1 45823404 utr 3 prime probably benign
PIT4378001:Wdr75 UTSW 1 45820173 missense probably damaging 0.98
R0060:Wdr75 UTSW 1 45816617 missense probably benign 0.16
R0463:Wdr75 UTSW 1 45819602 missense probably damaging 1.00
R0963:Wdr75 UTSW 1 45817310 missense probably benign 0.07
R1364:Wdr75 UTSW 1 45799062 missense probably benign 0.01
R1382:Wdr75 UTSW 1 45817311 missense probably damaging 1.00
R1562:Wdr75 UTSW 1 45803870 splice site probably null
R1909:Wdr75 UTSW 1 45823403 missense probably benign 0.00
R2968:Wdr75 UTSW 1 45817341 missense probably damaging 1.00
R3972:Wdr75 UTSW 1 45822554 missense probably benign 0.01
R4372:Wdr75 UTSW 1 45806673 unclassified probably benign
R4720:Wdr75 UTSW 1 45822485 missense probably benign 0.05
R4922:Wdr75 UTSW 1 45816478 missense probably damaging 1.00
R5201:Wdr75 UTSW 1 45823359 missense probably benign 0.00
R5242:Wdr75 UTSW 1 45817327 nonsense probably null
R5320:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R5450:Wdr75 UTSW 1 45812164 missense probably benign 0.26
R6072:Wdr75 UTSW 1 45799051 missense probably damaging 0.96
R6147:Wdr75 UTSW 1 45819538 missense probably benign 0.00
R6341:Wdr75 UTSW 1 45802131 critical splice donor site probably null
R6629:Wdr75 UTSW 1 45812056 missense probably damaging 1.00
R6646:Wdr75 UTSW 1 45799087 missense probably damaging 1.00
R6722:Wdr75 UTSW 1 45805352 intron probably null
R6750:Wdr75 UTSW 1 45817379 missense probably damaging 1.00
R6850:Wdr75 UTSW 1 45814598 missense probably benign 0.00
R6851:Wdr75 UTSW 1 45823427 missense probably benign
R7172:Wdr75 UTSW 1 45799134 missense probably damaging 1.00
R7248:Wdr75 UTSW 1 45817400 missense probably damaging 1.00
R7809:Wdr75 UTSW 1 45823436 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTCTCATATCCTCATATGGTTGAC -3'
(R):5'- AGTGTAGTTCTAGGCTATGGACC -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- GTAGTTCTAGGCTATGGACCTCTTTC -3'
Posted On2016-07-06