Incidental Mutation 'R0945:Synj1'
ID82078
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Namesynaptojanin 1
Synonyms
MMRRC Submission 039084-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0945 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90936092-91011308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90960445 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 905 (L905S)
Ref Sequence ENSEMBL: ENSMUSP00000113308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121759] [ENSMUST00000130813] [ENSMUST00000170853] [ENSMUST00000231472]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118246
Predicted Effect unknown
Transcript: ENSMUST00000118390
AA Change: L879S
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973
AA Change: L879S

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121759
AA Change: L905S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973
AA Change: L905S

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130813
SMART Domains Protein: ENSMUSP00000119712
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.4e-86 PFAM
low complexity region 441 459 N/A INTRINSIC
IPPc 526 693 1.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170853
AA Change: L865S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973
AA Change: L865S

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231472
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,111 M883V probably benign Het
Allc A G 12: 28,559,963 S212P probably benign Het
Anxa10 A G 8: 62,060,245 probably benign Het
Apoa2 A G 1: 171,225,699 probably null Het
Arfgef2 T C 2: 166,826,969 probably benign Het
Arhgap30 G T 1: 171,403,286 V204L probably damaging Het
Cd109 T A 9: 78,688,941 V852E possibly damaging Het
Ceacam5 T A 7: 17,747,344 Y339N probably damaging Het
Chaf1a A G 17: 56,067,441 D876G probably damaging Het
Chd9 A G 8: 90,933,002 K197E possibly damaging Het
Cnr2 A T 4: 135,917,321 M237L probably benign Het
Dnm2 C A 9: 21,505,660 Q830K probably damaging Het
Dst T C 1: 34,271,419 L1615P probably damaging Het
Eid1 A G 2: 125,673,577 D129G probably damaging Het
Exoc5 A G 14: 49,039,342 probably benign Het
Greb1 T C 12: 16,673,802 Y1854C probably benign Het
Il15ra T A 2: 11,718,327 V54E probably damaging Het
Il4i1 G A 7: 44,839,704 V306M probably damaging Het
Lrsam1 T C 2: 32,947,909 D211G probably benign Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Myrfl C T 10: 116,803,394 probably benign Het
Nell1 A G 7: 50,219,585 I203V probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr112 G A 17: 37,563,387 T308I probably benign Het
Olfr1234 T C 2: 89,363,255 Y58C probably damaging Het
Olfr654 T A 7: 104,588,672 N289K probably damaging Het
Pdxdc1 A G 16: 13,857,432 L345P probably damaging Het
Pex3 C A 10: 13,542,676 A79S probably benign Het
Pla2r1 A C 2: 60,458,410 L626R possibly damaging Het
Plcb3 A G 19: 6,954,878 S1107P probably damaging Het
Ppcdc C T 9: 57,420,158 probably null Het
Rbak A T 5: 143,173,579 F573Y probably damaging Het
Rfc1 A G 5: 65,278,709 probably null Het
Rpl13 C T 8: 123,105,174 A203V possibly damaging Het
Scn8a A G 15: 101,015,787 H1020R possibly damaging Het
Slf1 A G 13: 77,103,471 probably benign Het
Tmem59 T A 4: 107,187,725 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uri1 A T 7: 37,969,678 D127E probably damaging Het
Usp31 T C 7: 121,670,253 E489G probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp941 C T 7: 140,811,664 R594H probably damaging Het
Zfy1 T C Y: 725,983 D594G probably damaging Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90951976 missense probably damaging 1.00
IGL01468:Synj1 APN 16 91010172 splice site probably benign
IGL02209:Synj1 APN 16 90987419 missense probably damaging 0.97
IGL02452:Synj1 APN 16 90961365 splice site probably benign
IGL02619:Synj1 APN 16 90974045 missense probably damaging 1.00
IGL02650:Synj1 APN 16 90976696 missense probably benign 0.03
IGL02708:Synj1 APN 16 90991462 missense probably damaging 1.00
IGL02863:Synj1 APN 16 90961434 missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90988168 missense probably damaging 0.99
IGL03295:Synj1 APN 16 90938430 missense probably benign 0.14
IGL03356:Synj1 APN 16 90987392 missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90964508 missense probably damaging 1.00
R0179:Synj1 UTSW 16 90964631 missense possibly damaging 0.80
R0396:Synj1 UTSW 16 90938640 missense probably benign
R0426:Synj1 UTSW 16 90967354 missense probably damaging 1.00
R0486:Synj1 UTSW 16 90938263 utr 3 prime probably benign
R0515:Synj1 UTSW 16 90994022 missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90948087 missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0698:Synj1 UTSW 16 90960615 missense probably benign 0.44
R1327:Synj1 UTSW 16 90946855 missense probably benign 0.05
R1562:Synj1 UTSW 16 90987402 missense probably benign 0.09
R1732:Synj1 UTSW 16 90964230 missense probably damaging 0.99
R1752:Synj1 UTSW 16 90938473 missense probably benign
R1785:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R1786:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R2011:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2012:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2065:Synj1 UTSW 16 90991649 critical splice acceptor site probably null
R2862:Synj1 UTSW 16 90969329 missense probably damaging 1.00
R3026:Synj1 UTSW 16 90978734 missense probably damaging 1.00
R3151:Synj1 UTSW 16 90960626 missense probably damaging 0.96
R3946:Synj1 UTSW 16 91010096 missense possibly damaging 0.48
R3971:Synj1 UTSW 16 90991603 missense probably damaging 1.00
R4472:Synj1 UTSW 16 90969181 critical splice donor site probably null
R4547:Synj1 UTSW 16 90988282 missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90973989 missense probably damaging 1.00
R4739:Synj1 UTSW 16 90955419 missense probably benign 0.00
R5027:Synj1 UTSW 16 90940519 intron probably null
R5428:Synj1 UTSW 16 90991518 missense probably damaging 0.98
R5586:Synj1 UTSW 16 91009977 intron probably benign
R5769:Synj1 UTSW 16 90938253 utr 3 prime probably benign
R6005:Synj1 UTSW 16 90969286 missense probably damaging 1.00
R6119:Synj1 UTSW 16 90938989 missense probably benign 0.30
R6313:Synj1 UTSW 16 90946815 missense probably benign 0.00
R6324:Synj1 UTSW 16 90938630 missense probably benign 0.00
R6549:Synj1 UTSW 16 90938677 missense probably benign
R6696:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6698:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6861:Synj1 UTSW 16 90963880 nonsense probably null
R7008:Synj1 UTSW 16 90993945 missense probably damaging 1.00
R7153:Synj1 UTSW 16 90948090 missense probably benign 0.04
R7393:Synj1 UTSW 16 90951999 missense probably damaging 0.99
R7510:Synj1 UTSW 16 90938677 missense probably benign
R7560:Synj1 UTSW 16 90940483 missense probably benign
R7724:Synj1 UTSW 16 90961499 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGTGCAAACTGCCGCAGAAG -3'
(R):5'- CTCAGACTGCTGAAGGTTCCAGAAG -3'

Sequencing Primer
(F):5'- TGCCGCAGAAGCTCATC -3'
(R):5'- GATCTCCTGAATGCTAGTTTCCAAG -3'
Posted On2013-11-08