Incidental Mutation 'R0966:Olfr68'
ID84053
Institutional Source Beutler Lab
Gene Symbol Olfr68
Ensembl Gene ENSMUSG00000061626
Gene Nameolfactory receptor 68
Synonyms3'[b]2, MOR22-3, GA_x6K02T2PBJ9-6504436-6503489
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0966 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103774358-103779698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103777449 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 299 (T299S)
Ref Sequence ENSEMBL: ENSMUSP00000150493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072513] [ENSMUST00000216811]
Predicted Effect probably damaging
Transcript: ENSMUST00000072513
AA Change: T299S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072329
Gene: ENSMUSG00000061626
AA Change: T299S

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 3e-101 PFAM
Pfam:7TM_GPCR_Srx 34 237 4.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 37 264 1.7e-6 PFAM
Pfam:7tm_1 43 295 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216811
AA Change: T299S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in Olfr68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Olfr68 APN 7 103778241 missense probably benign
IGL03310:Olfr68 APN 7 103777427 missense probably benign 0.04
R0135:Olfr68 UTSW 7 103777763 missense probably damaging 0.99
R0462:Olfr68 UTSW 7 103777563 missense probably benign 0.37
R1199:Olfr68 UTSW 7 103777985 missense probably damaging 1.00
R1288:Olfr68 UTSW 7 103778042 missense possibly damaging 0.94
R1597:Olfr68 UTSW 7 103778060 missense probably benign
R4631:Olfr68 UTSW 7 103777475 missense probably damaging 1.00
R4754:Olfr68 UTSW 7 103777668 missense probably benign 0.00
R5184:Olfr68 UTSW 7 103777404 missense probably benign 0.00
R5654:Olfr68 UTSW 7 103777975 missense probably damaging 1.00
R8026:Olfr68 UTSW 7 103778340 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGAATTCACATGCGACAGCA -3'
(R):5'- GCCATTGTGAAACTGGCAGCTC -3'

Sequencing Primer
(F):5'- GCGACAGCATATATTTGTATTGGAG -3'
(R):5'- AGGCTCGATTCAAAGCCTTC -3'
Posted On2013-11-08