Incidental Mutation 'R0966:Gm5724'
ID84052
Institutional Source Beutler Lab
Gene Symbol Gm5724
Ensembl Gene ENSMUSG00000084927
Gene Namepredicted gene 5724
Synonyms
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0966 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141708118-141773810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141727573 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 413 (F413S)
Ref Sequence ENSEMBL: ENSMUSP00000117177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148411]
Predicted Effect probably benign
Transcript: ENSMUST00000148411
AA Change: F413S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117177
Gene: ENSMUSG00000084927
AA Change: F413S

DomainStartEndE-ValueType
Pfam:MFS_1 22 405 3.4e-26 PFAM
KAZAL 438 484 1.71e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in Gm5724
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Gm5724 APN 6 141754429 missense probably benign 0.14
IGL01347:Gm5724 APN 6 141754466 nonsense probably null
IGL01539:Gm5724 APN 6 141727607 missense possibly damaging 0.88
IGL01613:Gm5724 APN 6 141713214 missense possibly damaging 0.67
IGL02060:Gm5724 APN 6 141754408 missense probably benign 0.00
IGL02063:Gm5724 APN 6 141738889 missense probably benign 0.01
IGL02126:Gm5724 APN 6 141739013 missense probably benign 0.29
IGL02214:Gm5724 APN 6 141723185 missense possibly damaging 0.50
IGL02630:Gm5724 APN 6 141723110 missense probably damaging 1.00
R1082:Gm5724 UTSW 6 141712133 missense probably damaging 1.00
R1433:Gm5724 UTSW 6 141765703 missense probably benign 0.00
R1571:Gm5724 UTSW 6 141754409 nonsense probably null
R1765:Gm5724 UTSW 6 141754358 splice site probably benign
R2055:Gm5724 UTSW 6 141725455 missense probably benign 0.33
R2174:Gm5724 UTSW 6 141727593 nonsense probably null
R2495:Gm5724 UTSW 6 141765777 missense probably benign 0.02
R2857:Gm5724 UTSW 6 141744538 missense probably benign 0.35
R3551:Gm5724 UTSW 6 141708596 missense probably benign 0.20
R3824:Gm5724 UTSW 6 141754374 missense possibly damaging 0.50
R3912:Gm5724 UTSW 6 141727636 missense probably damaging 0.97
R3942:Gm5724 UTSW 6 141727714 missense probably damaging 0.98
R4161:Gm5724 UTSW 6 141708596 missense probably benign 0.20
R4168:Gm5724 UTSW 6 141738947 missense probably benign 0.03
R4395:Gm5724 UTSW 6 141712118 missense probably benign 0.02
R4720:Gm5724 UTSW 6 141723222 missense probably damaging 1.00
R4732:Gm5724 UTSW 6 141723179 missense probably benign 0.01
R4733:Gm5724 UTSW 6 141723179 missense probably benign 0.01
R4794:Gm5724 UTSW 6 141767562 missense probably benign 0.11
R5062:Gm5724 UTSW 6 141767454 missense possibly damaging 0.46
R5389:Gm5724 UTSW 6 141740467 missense probably benign 0.12
R5419:Gm5724 UTSW 6 141736100 splice site probably null
R5423:Gm5724 UTSW 6 141744462 missense probably damaging 1.00
R5704:Gm5724 UTSW 6 141713254 missense probably benign 0.00
R5973:Gm5724 UTSW 6 141754456 missense probably benign 0.01
R6041:Gm5724 UTSW 6 141739038 missense probably benign 0.11
R6284:Gm5724 UTSW 6 141725393 missense probably damaging 1.00
R6395:Gm5724 UTSW 6 141723092 splice site probably null
R6993:Gm5724 UTSW 6 141765742 missense possibly damaging 0.94
R7149:Gm5724 UTSW 6 141744452 missense probably damaging 1.00
R7159:Gm5724 UTSW 6 141773778 start codon destroyed probably damaging 1.00
R7627:Gm5724 UTSW 6 141744545 missense probably damaging 1.00
R7784:Gm5724 UTSW 6 141713193 critical splice donor site probably null
R7873:Gm5724 UTSW 6 141727722 missense probably benign 0.44
X0020:Gm5724 UTSW 6 141754365 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTAGATAACTGTGGATCACTGCTGTC -3'
(R):5'- CCCAGAGCTGAGTCAAATTCCCAAT -3'

Sequencing Primer
(F):5'- GGATCACTGCTGTCAAGTCAC -3'
(R):5'- tgtgtgtgtgtttgtgtctg -3'
Posted On2013-11-08