Mutagenetix > Incidental Mutations

Incidental Mutation 'R0966:Gm5724'

84052

Institutional Source

Beutler Lab

Gene Symbol

Gm5724

Ensembl Gene

ENSMUSG00000084927

Gene Name

predicted gene 5724

Synonyms

MMRRC Submission

039095-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R0966 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141708118-141773810 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 141727573 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 413 (F413S)

Ref Sequence

ENSEMBL: ENSMUSP00000117177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148411]

AlphaFold

L7N264

Predicted Effect

probably benign
Transcript: ENSMUST00000148411
AA Change: F413S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000117177
Gene: ENSMUSG00000084927
AA Change: F413S

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	405	3.4e-26	PFAM
KAZAL	438	484	1.71e0	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.8%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	T	A	16: 88,707,422	R162S	probably damaging	Het
Arhgef10	T	G	8: 14,940,343	S272A	probably benign	Het
Cd101	A	C	3: 101,008,222	S676R	probably benign	Het
Efcab5	G	A	11: 77,140,923	R42W	probably damaging	Het
Flrt2	T	C	12: 95,780,301	V471A	possibly damaging	Het
Fzd8	A	T	18: 9,214,745	E609V	probably damaging	Het
Gm10110	A	C	14: 89,898,119		noncoding transcript	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Igf2bp2	C	T	16: 22,089,090	R19Q	probably damaging	Het
Mmp16	C	G	4: 18,115,930	N511K	probably benign	Het
Myo7b	T	C	18: 31,998,763	H460R	probably damaging	Het
Olfr68	T	A	7: 103,777,449	T299S	probably damaging	Het
Plekhh1	T	C	12: 79,065,730	F594L	probably damaging	Het
Prkca	T	A	11: 108,014,284	K209N	possibly damaging	Het
Slc5a2	G	C	7: 128,270,631	R412P	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,128	V63I	probably benign	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Vps36	G	A	8: 22,206,817	W131*	probably null	Het
Wdr3	A	T	3: 100,161,069	V41E	probably damaging	Het

Other mutations in Gm5724

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Gm5724	APN	6	141754429	missense	probably benign	0.14
IGL01347:Gm5724	APN	6	141754466	nonsense	probably null
IGL01539:Gm5724	APN	6	141727607	missense	possibly damaging	0.88
IGL01613:Gm5724	APN	6	141713214	missense	possibly damaging	0.67
IGL02060:Gm5724	APN	6	141754408	missense	probably benign	0.00
IGL02063:Gm5724	APN	6	141738889	missense	probably benign	0.01
IGL02126:Gm5724	APN	6	141739013	missense	probably benign	0.29
IGL02214:Gm5724	APN	6	141723185	missense	possibly damaging	0.50
IGL02630:Gm5724	APN	6	141723110	missense	probably damaging	1.00
R1082:Gm5724	UTSW	6	141712133	missense	probably damaging	1.00
R1433:Gm5724	UTSW	6	141765703	missense	probably benign	0.00
R1571:Gm5724	UTSW	6	141754409	nonsense	probably null
R1765:Gm5724	UTSW	6	141754358	splice site	probably benign
R2055:Gm5724	UTSW	6	141725455	missense	probably benign	0.33
R2174:Gm5724	UTSW	6	141727593	nonsense	probably null
R2495:Gm5724	UTSW	6	141765777	missense	probably benign	0.02
R2857:Gm5724	UTSW	6	141744538	missense	probably benign	0.35
R3551:Gm5724	UTSW	6	141708596	missense	probably benign	0.20
R3824:Gm5724	UTSW	6	141754374	missense	possibly damaging	0.50
R3912:Gm5724	UTSW	6	141727636	missense	probably damaging	0.97
R3942:Gm5724	UTSW	6	141727714	missense	probably damaging	0.98
R4161:Gm5724	UTSW	6	141708596	missense	probably benign	0.20
R4168:Gm5724	UTSW	6	141738947	missense	probably benign	0.03
R4395:Gm5724	UTSW	6	141712118	missense	probably benign	0.02
R4720:Gm5724	UTSW	6	141723222	missense	probably damaging	1.00
R4732:Gm5724	UTSW	6	141723179	missense	probably benign	0.01
R4733:Gm5724	UTSW	6	141723179	missense	probably benign	0.01
R4794:Gm5724	UTSW	6	141767562	missense	probably benign	0.11
R5062:Gm5724	UTSW	6	141767454	missense	possibly damaging	0.46
R5389:Gm5724	UTSW	6	141740467	missense	probably benign	0.12
R5419:Gm5724	UTSW	6	141736100	splice site	probably null
R5423:Gm5724	UTSW	6	141744462	missense	probably damaging	1.00
R5704:Gm5724	UTSW	6	141713254	missense	probably benign	0.00
R5973:Gm5724	UTSW	6	141754456	missense	probably benign	0.01
R6041:Gm5724	UTSW	6	141739038	missense	probably benign	0.11
R6284:Gm5724	UTSW	6	141725393	missense	probably damaging	1.00
R6395:Gm5724	UTSW	6	141723092	splice site	probably null
R6993:Gm5724	UTSW	6	141765742	missense	possibly damaging	0.94
R7149:Gm5724	UTSW	6	141744452	missense	probably damaging	1.00
R7159:Gm5724	UTSW	6	141773778	start codon destroyed	probably damaging	1.00
R7627:Gm5724	UTSW	6	141744545	missense	probably damaging	1.00
R7784:Gm5724	UTSW	6	141713193	critical splice donor site	probably null
R7873:Gm5724	UTSW	6	141727722	missense	probably benign	0.44
R8670:Gm5724	UTSW	6	141765742	missense	possibly damaging	0.94
R8720:Gm5724	UTSW	6	141723126	missense	probably benign	0.01
R9124:Gm5724	UTSW	6	141723104	missense	possibly damaging	0.81
R9238:Gm5724	UTSW	6	141740427	missense	probably damaging	0.98
R9381:Gm5724	UTSW	6	141765764	missense	probably benign	0.00
X0020:Gm5724	UTSW	6	141754365	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTAGATAACTGTGGATCACTGCTGTC -3'
(R):5'- CCCAGAGCTGAGTCAAATTCCCAAT -3'

Sequencing Primer
(F):5'- GGATCACTGCTGTCAAGTCAC -3'
(R):5'- tgtgtgtgtgtttgtgtctg -3'

Posted On

2013-11-08