Incidental Mutation 'R0966:Igf2bp2'
ID84065
Institutional Source Beutler Lab
Gene Symbol Igf2bp2
Ensembl Gene ENSMUSG00000033581
Gene Nameinsulin-like growth factor 2 mRNA binding protein 2
SynonymsIMP-2, C330012H03Rik
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R0966 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22059009-22163299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22089090 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 19 (R19Q)
Ref Sequence ENSEMBL: ENSMUSP00000111037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100052] [ENSMUST00000115379]
Predicted Effect probably damaging
Transcript: ENSMUST00000100052
AA Change: R87Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097629
Gene: ENSMUSG00000033581
AA Change: R87Q

DomainStartEndE-ValueType
RRM 4 72 8.2e-11 SMART
RRM 83 153 4.07e-6 SMART
KH 185 256 1.28e-14 SMART
KH 266 339 1.97e-15 SMART
low complexity region 375 391 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
KH 419 490 1.1e-13 SMART
KH 501 573 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115379
AA Change: R19Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111037
Gene: ENSMUSG00000033581
AA Change: R19Q

DomainStartEndE-ValueType
RRM 15 85 4.07e-6 SMART
KH 117 188 1.28e-14 SMART
KH 198 271 1.97e-15 SMART
low complexity region 307 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
KH 351 422 1.1e-13 SMART
KH 433 505 2.48e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232504
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the 5' UTR of insulin-like growth factor 2 (IGF2) mRNA and regulates its translation. It plays an important role in metabolism and variation in this gene is associated with susceptibility to diabetes. Alternative splicing and promoter usage results in multiple transcript variants. Related pseudogenes are found on several chromosomes. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in Igf2bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Igf2bp2 APN 16 22063704 missense probably damaging 1.00
IGL02374:Igf2bp2 APN 16 22081868 missense probably benign 0.00
IGL02752:Igf2bp2 APN 16 22080110 missense probably benign 0.00
IGL02884:Igf2bp2 APN 16 22162885 missense probably benign 0.00
IGL03072:Igf2bp2 APN 16 22068141 critical splice donor site probably null
defender UTSW 16 22070306 critical splice donor site probably null
Petite UTSW 16 22079608 critical splice acceptor site probably null
R0505_igf2bp2_524 UTSW 16 22089099 missense possibly damaging 0.90
R0008:Igf2bp2 UTSW 16 22076091 missense probably benign 0.22
R0183:Igf2bp2 UTSW 16 22078730 nonsense probably null
R0390:Igf2bp2 UTSW 16 22081801 missense possibly damaging 0.87
R0505:Igf2bp2 UTSW 16 22089099 missense possibly damaging 0.90
R0610:Igf2bp2 UTSW 16 22070309 missense probably benign 0.00
R0696:Igf2bp2 UTSW 16 22080125 missense probably benign 0.19
R1101:Igf2bp2 UTSW 16 22162950 missense probably damaging 1.00
R1159:Igf2bp2 UTSW 16 22061853 splice site probably benign
R1169:Igf2bp2 UTSW 16 22078730 nonsense probably null
R1762:Igf2bp2 UTSW 16 22083947 nonsense probably null
R2168:Igf2bp2 UTSW 16 22079608 critical splice acceptor site probably null
R4014:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4015:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4016:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4017:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4128:Igf2bp2 UTSW 16 22078621 missense probably benign 0.00
R4986:Igf2bp2 UTSW 16 22070306 critical splice donor site probably null
R5007:Igf2bp2 UTSW 16 22079496 missense probably damaging 1.00
R5268:Igf2bp2 UTSW 16 22079491 missense probably damaging 1.00
R5531:Igf2bp2 UTSW 16 22089085 missense probably damaging 1.00
R6154:Igf2bp2 UTSW 16 22076093 nonsense probably null
R6819:Igf2bp2 UTSW 16 22060836 missense probably damaging 1.00
R6975:Igf2bp2 UTSW 16 22061861 missense probably null 1.00
R7008:Igf2bp2 UTSW 16 22081832 missense probably benign 0.16
R7311:Igf2bp2 UTSW 16 22061882 missense possibly damaging 0.76
R8011:Igf2bp2 UTSW 16 22076099 missense probably damaging 1.00
R8045:Igf2bp2 UTSW 16 22083978 missense possibly damaging 0.82
R8442:Igf2bp2 UTSW 16 22065091 critical splice donor site probably null
R8826:Igf2bp2 UTSW 16 22065116 missense probably damaging 1.00
R8947:Igf2bp2 UTSW 16 22078723 nonsense probably null
X0066:Igf2bp2 UTSW 16 22161291 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGGTCATCAAACCACATGGCTGG -3'
(R):5'- GGACACAAGTGTTGACTTCTGCGAG -3'

Sequencing Primer
(F):5'- TACCTGAGGGAGCCACCTG -3'
(R):5'- CCATAGCATTTGTGACTTTACCAG -3'
Posted On2013-11-08