Incidental Mutation 'R0966:Mmp16'
ID84050
Institutional Source Beutler Lab
Gene Symbol Mmp16
Ensembl Gene ENSMUSG00000028226
Gene Namematrix metallopeptidase 16
SynonymsMT3-MMP, Membrane type 3-MMP
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0966 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location17852893-18119145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 18115930 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 511 (N511K)
Ref Sequence ENSEMBL: ENSMUSP00000029881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029881] [ENSMUST00000183662]
Predicted Effect probably benign
Transcript: ENSMUST00000029881
AA Change: N511K

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029881
Gene: ENSMUSG00000028226
AA Change: N511K

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 3e-11 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
HX 392 436 3.61e-12 SMART
HX 439 485 1.86e-14 SMART
HX 487 532 4.96e-10 SMART
Pfam:DUF3377 537 607 6.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183662
SMART Domains Protein: ENSMUSP00000139102
Gene: ENSMUSG00000028226

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 9.9e-12 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit retarded growth of the skeleton, especially in the cranium and long bones. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a null allele exhibit reduced skeletal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in Mmp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Mmp16 APN 4 18011784 missense probably benign 0.03
IGL01074:Mmp16 APN 4 18110584 splice site probably benign
IGL01125:Mmp16 APN 4 18112066 missense possibly damaging 0.95
IGL01309:Mmp16 APN 4 18116185 missense probably damaging 0.98
IGL01543:Mmp16 APN 4 18051743 missense probably damaging 1.00
IGL02036:Mmp16 APN 4 18093371 missense probably benign 0.00
IGL02252:Mmp16 APN 4 18110523 missense probably damaging 1.00
IGL03037:Mmp16 APN 4 17996222 missense probably damaging 0.98
R0483:Mmp16 UTSW 4 18115878 splice site probably benign
R0565:Mmp16 UTSW 4 17987705 missense probably damaging 1.00
R0885:Mmp16 UTSW 4 18054491 missense probably benign 0.12
R1158:Mmp16 UTSW 4 17987726 splice site probably null
R1290:Mmp16 UTSW 4 18051725 missense probably damaging 1.00
R1326:Mmp16 UTSW 4 18054517 missense possibly damaging 0.61
R1345:Mmp16 UTSW 4 18112021 missense probably benign 0.01
R1424:Mmp16 UTSW 4 18112121 splice site probably null
R1610:Mmp16 UTSW 4 18011582 missense probably benign 0.00
R1722:Mmp16 UTSW 4 18051767 missense probably damaging 1.00
R1867:Mmp16 UTSW 4 18116013 missense probably benign 0.00
R2354:Mmp16 UTSW 4 18112001 missense probably damaging 1.00
R2431:Mmp16 UTSW 4 18054491 missense probably benign 0.12
R2992:Mmp16 UTSW 4 18011657 missense probably damaging 1.00
R5245:Mmp16 UTSW 4 18054596 intron probably benign
R5534:Mmp16 UTSW 4 18110452 missense probably damaging 0.99
R5941:Mmp16 UTSW 4 18054354 splice site probably benign
R5961:Mmp16 UTSW 4 17853842 missense probably benign 0.37
R6160:Mmp16 UTSW 4 18051857 missense probably damaging 1.00
R6514:Mmp16 UTSW 4 18116123 missense probably damaging 1.00
R6570:Mmp16 UTSW 4 18011501 missense possibly damaging 0.64
R6866:Mmp16 UTSW 4 17853800 missense probably benign 0.23
R7037:Mmp16 UTSW 4 18116148 missense possibly damaging 0.95
R7168:Mmp16 UTSW 4 18110550 missense probably damaging 1.00
R7268:Mmp16 UTSW 4 18093366 missense probably benign
R7635:Mmp16 UTSW 4 18054382 missense probably benign 0.00
R7799:Mmp16 UTSW 4 18112112 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTTACACCACAAGCACTGGGGAG -3'
(R):5'- CGTTTACAGTACAGTATGTGGCGGG -3'

Sequencing Primer
(F):5'- caagggaagggaagggaag -3'
(R):5'- TCCTCTTGAACTGGAACACAGTG -3'
Posted On2013-11-08