Incidental Mutation 'R1055:Clrn1'
ID94252
Institutional Source Beutler Lab
Gene Symbol Clrn1
Ensembl Gene ENSMUSG00000043850
Gene Nameclarin 1
SynonymsUsh3a, A130002D11Rik, USH3, clarin-1
MMRRC Submission 039145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1055 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location58844028-58885340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58865110 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 117 (I117F)
Ref Sequence ENSEMBL: ENSMUSP00000052254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051408] [ENSMUST00000055636] [ENSMUST00000072551]
Predicted Effect probably benign
Transcript: ENSMUST00000051408
AA Change: I99F

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000051738
Gene: ENSMUSG00000043850
AA Change: I99F

DomainStartEndE-ValueType
Pfam:Claudin_2 18 208 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055636
AA Change: I117F

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052254
Gene: ENSMUSG00000043850
AA Change: I117F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072551
SMART Domains Protein: ENSMUSP00000072363
Gene: ENSMUSG00000043850

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1hw7a_ 65 87 5e-3 SMART
transmembrane domain 129 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161419
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.3%
  • 20x: 87.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss and loss of balance associated with defects in outer hair cells and supporting cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 63,973,275 V168A possibly damaging Het
A1cf C A 19: 31,932,519 T237N probably benign Het
Actl10 A T 2: 154,552,668 Q180L probably benign Het
Adcy1 T C 11: 7,109,075 L327P probably damaging Het
Adcy7 T C 8: 88,318,057 probably benign Het
Ahctf1 G A 1: 179,763,486 T1243I possibly damaging Het
Akap6 C T 12: 52,880,672 Q122* probably null Het
Apob G A 12: 7,994,963 G861D probably damaging Het
Arhgef11 A C 3: 87,717,118 T539P probably benign Het
Cd244 T A 1: 171,577,276 V232E probably damaging Het
Chia1 A C 3: 106,130,883 D365A probably damaging Het
Clpsl2 C T 17: 28,549,526 Q5* probably null Het
Csmd3 A G 15: 47,881,537 L1354P probably damaging Het
Csn2 G A 5: 87,694,737 P144S possibly damaging Het
D17Wsu92e T C 17: 27,767,936 N272S probably damaging Het
Dcdc2a T A 13: 25,102,610 M172K probably damaging Het
Dnah9 A T 11: 66,160,011 W152R probably damaging Het
Dnmt3a T A 12: 3,872,864 S82T probably benign Het
Ebf1 A G 11: 44,632,775 K146E probably damaging Het
Gfpt2 A C 11: 49,827,211 R504S probably damaging Het
Gpank1 T A 17: 35,124,308 S255T probably damaging Het
Greb1 T C 12: 16,682,251 M1570V probably damaging Het
Gtf2i A T 5: 134,263,624 I403K probably damaging Het
Hoxc11 T A 15: 102,954,835 C104S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Khdrbs2 A T 1: 32,644,157 probably benign Het
Lix1l G T 3: 96,621,310 G200V probably damaging Het
Lrrc23 T C 6: 124,778,151 N141S probably damaging Het
March11 A T 15: 26,309,662 D134V probably damaging Het
Myo9a A T 9: 59,855,370 T795S probably benign Het
Nhsl1 T A 10: 18,525,475 D782E probably benign Het
Nptxr T C 15: 79,790,255 probably benign Het
Nrp1 A G 8: 128,468,598 M512V possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1126 ATTGCTACTC A 2: 87,457,437 probably benign Het
Olfr1469 G A 19: 13,411,390 A274T probably benign Het
Pard3 T C 8: 127,378,280 F267S probably benign Het
Pomt2 G A 12: 87,147,480 T50M possibly damaging Het
Qsox2 A G 2: 26,214,125 Y298H probably damaging Het
Rabgap1 A G 2: 37,492,068 K450E possibly damaging Het
Rpa1 A T 11: 75,302,732 V591D probably damaging Het
Sall3 A C 18: 80,969,792 M1143R probably benign Het
Scgb1b19 G T 7: 33,287,343 A13S unknown Het
Scn1a T C 2: 66,337,996 T89A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sdr42e1 T G 8: 117,663,584 N106T probably damaging Het
Shpk A T 11: 73,215,119 M266L probably benign Het
Slc34a1 G T 13: 55,403,033 R139L probably benign Het
Smbd1 C A 16: 32,806,718 D67Y probably damaging Het
Srd5a3 A G 5: 76,153,638 N238S probably benign Het
Tmprss2 T C 16: 97,576,262 N212D probably damaging Het
Uap1 G T 1: 170,156,911 probably benign Het
Ugt1a6a A G 1: 88,139,014 M181V probably benign Het
Vmn2r32 C T 7: 7,474,327 W355* probably null Het
Vmn2r86 T A 10: 130,446,357 S797C probably damaging Het
Wiz A G 17: 32,387,642 S40P probably damaging Het
Zfand6 A G 7: 84,615,973 probably benign Het
Zfp280d G A 9: 72,329,167 probably null Het
Other mutations in Clrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Clrn1 APN 3 58885025 missense probably damaging 0.99
IGL03184:Clrn1 APN 3 58846224 missense probably benign 0.00
IGL03187:Clrn1 APN 3 58846433 missense probably damaging 0.99
R0015:Clrn1 UTSW 3 58846427 missense probably damaging 0.99
R0015:Clrn1 UTSW 3 58846427 missense probably damaging 0.99
R2301:Clrn1 UTSW 3 58846352 missense probably damaging 1.00
R4753:Clrn1 UTSW 3 58884897 missense probably damaging 1.00
R5493:Clrn1 UTSW 3 58846416 missense probably damaging 1.00
R5916:Clrn1 UTSW 3 58846362 missense probably benign 0.13
R6393:Clrn1 UTSW 3 58846320 missense probably damaging 1.00
R6719:Clrn1 UTSW 3 58846440 missense probably damaging 0.99
R7722:Clrn1 UTSW 3 58846334 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AGGACATCCTTTCACAGACTGAAAAGC -3'
(R):5'- ATCTTTGGGCAAAACCCCTGGC -3'

Sequencing Primer
(F):5'- TCACAGACTGAAAAGCACTTTGTC -3'
(R):5'- CCCCTGGCAAATTGGTAAGTG -3'
Posted On2014-01-05