Incidental Mutation 'R1055:Zfp280d'
ID94281
Institutional Source Beutler Lab
Gene Symbol Zfp280d
Ensembl Gene ENSMUSG00000038535
Gene Namezinc finger protein 280D
SynonymsSuhw4
MMRRC Submission 039145-MU
Accession Numbers

Ncbi RefSeq: NM_146224.4; MGI:2384583

Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R1055 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72274860-72363777 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 72329167 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098576] [ENSMUST00000183410] [ENSMUST00000183410] [ENSMUST00000183801] [ENSMUST00000184019] [ENSMUST00000184036] [ENSMUST00000184036] [ENSMUST00000184053] [ENSMUST00000184399] [ENSMUST00000184517]
Predicted Effect probably null
Transcript: ENSMUST00000098576
SMART Domains Protein: ENSMUSP00000096175
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 241 6.8e-82 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183410
SMART Domains Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 4.1e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183410
SMART Domains Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 4.1e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183459
Predicted Effect probably benign
Transcript: ENSMUST00000183801
SMART Domains Protein: ENSMUSP00000139091
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 1.9e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184019
SMART Domains Protein: ENSMUSP00000138994
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
ZnF_C2H2 42 65 1.23e1 SMART
ZnF_C2H2 88 112 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184025
Predicted Effect probably null
Transcript: ENSMUST00000184036
SMART Domains Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:DUF4195 32 217 5.5e-98 PFAM
ZnF_C2H2 227 247 1.24e2 SMART
ZnF_C2H2 308 330 6.92e0 SMART
ZnF_C2H2 345 368 3.99e0 SMART
ZnF_C2H2 375 398 1.08e-1 SMART
ZnF_C2H2 405 428 3.52e-1 SMART
ZnF_C2H2 434 456 2.41e1 SMART
ZnF_C2H2 462 484 3.38e1 SMART
low complexity region 514 536 N/A INTRINSIC
low complexity region 566 586 N/A INTRINSIC
ZnF_C2H2 631 654 1.23e1 SMART
ZnF_C2H2 677 701 1.34e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184036
SMART Domains Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:DUF4195 32 217 5.5e-98 PFAM
ZnF_C2H2 227 247 1.24e2 SMART
ZnF_C2H2 308 330 6.92e0 SMART
ZnF_C2H2 345 368 3.99e0 SMART
ZnF_C2H2 375 398 1.08e-1 SMART
ZnF_C2H2 405 428 3.52e-1 SMART
ZnF_C2H2 434 456 2.41e1 SMART
ZnF_C2H2 462 484 3.38e1 SMART
low complexity region 514 536 N/A INTRINSIC
low complexity region 566 586 N/A INTRINSIC
ZnF_C2H2 631 654 1.23e1 SMART
ZnF_C2H2 677 701 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184053
SMART Domains Protein: ENSMUSP00000138848
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 147 1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184141
Predicted Effect probably benign
Transcript: ENSMUST00000184399
SMART Domains Protein: ENSMUSP00000138902
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 103 4.8e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000184517
SMART Domains Protein: ENSMUSP00000138970
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 2.2e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.3%
  • 20x: 87.5%
Validation Efficiency 100% (58/58)
Allele List at MGI

All alleles(100) : Targeted(2) Gene trapped(98)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 63,973,275 V168A possibly damaging Het
A1cf C A 19: 31,932,519 T237N probably benign Het
Actl10 A T 2: 154,552,668 Q180L probably benign Het
Adcy1 T C 11: 7,109,075 L327P probably damaging Het
Adcy7 T C 8: 88,318,057 probably benign Het
Ahctf1 G A 1: 179,763,486 T1243I possibly damaging Het
Akap6 C T 12: 52,880,672 Q122* probably null Het
Apob G A 12: 7,994,963 G861D probably damaging Het
Arhgef11 A C 3: 87,717,118 T539P probably benign Het
Cd244 T A 1: 171,577,276 V232E probably damaging Het
Chia1 A C 3: 106,130,883 D365A probably damaging Het
Clpsl2 C T 17: 28,549,526 Q5* probably null Het
Clrn1 T A 3: 58,865,110 I117F probably benign Het
Csmd3 A G 15: 47,881,537 L1354P probably damaging Het
Csn2 G A 5: 87,694,737 P144S possibly damaging Het
D17Wsu92e T C 17: 27,767,936 N272S probably damaging Het
Dcdc2a T A 13: 25,102,610 M172K probably damaging Het
Dnah9 A T 11: 66,160,011 W152R probably damaging Het
Dnmt3a T A 12: 3,872,864 S82T probably benign Het
Ebf1 A G 11: 44,632,775 K146E probably damaging Het
Gfpt2 A C 11: 49,827,211 R504S probably damaging Het
Gpank1 T A 17: 35,124,308 S255T probably damaging Het
Greb1 T C 12: 16,682,251 M1570V probably damaging Het
Gtf2i A T 5: 134,263,624 I403K probably damaging Het
Hoxc11 T A 15: 102,954,835 C104S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Khdrbs2 A T 1: 32,644,157 probably benign Het
Lix1l G T 3: 96,621,310 G200V probably damaging Het
Lrrc23 T C 6: 124,778,151 N141S probably damaging Het
March11 A T 15: 26,309,662 D134V probably damaging Het
Myo9a A T 9: 59,855,370 T795S probably benign Het
Nhsl1 T A 10: 18,525,475 D782E probably benign Het
Nptxr T C 15: 79,790,255 probably benign Het
Nrp1 A G 8: 128,468,598 M512V possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1126 ATTGCTACTC A 2: 87,457,437 probably benign Het
Olfr1469 G A 19: 13,411,390 A274T probably benign Het
Pard3 T C 8: 127,378,280 F267S probably benign Het
Pomt2 G A 12: 87,147,480 T50M possibly damaging Het
Qsox2 A G 2: 26,214,125 Y298H probably damaging Het
Rabgap1 A G 2: 37,492,068 K450E possibly damaging Het
Rpa1 A T 11: 75,302,732 V591D probably damaging Het
Sall3 A C 18: 80,969,792 M1143R probably benign Het
Scgb1b19 G T 7: 33,287,343 A13S unknown Het
Scn1a T C 2: 66,337,996 T89A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sdr42e1 T G 8: 117,663,584 N106T probably damaging Het
Shpk A T 11: 73,215,119 M266L probably benign Het
Slc34a1 G T 13: 55,403,033 R139L probably benign Het
Smbd1 C A 16: 32,806,718 D67Y probably damaging Het
Srd5a3 A G 5: 76,153,638 N238S probably benign Het
Tmprss2 T C 16: 97,576,262 N212D probably damaging Het
Uap1 G T 1: 170,156,911 probably benign Het
Ugt1a6a A G 1: 88,139,014 M181V probably benign Het
Vmn2r32 C T 7: 7,474,327 W355* probably null Het
Vmn2r86 T A 10: 130,446,357 S797C probably damaging Het
Wiz A G 17: 32,387,642 S40P probably damaging Het
Zfand6 A G 7: 84,615,973 probably benign Het
Other mutations in Zfp280d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zfp280d APN 9 72322571 missense probably damaging 1.00
IGL00708:Zfp280d APN 9 72312135 missense probably benign 0.19
IGL01333:Zfp280d APN 9 72335114 splice site probably benign
IGL01453:Zfp280d APN 9 72322586 missense possibly damaging 0.90
IGL02472:Zfp280d APN 9 72301711 missense probably damaging 1.00
IGL02583:Zfp280d APN 9 72322445 splice site probably benign
IGL02608:Zfp280d APN 9 72307979 missense probably damaging 0.98
IGL02675:Zfp280d APN 9 72312222 missense probably benign 0.33
IGL02676:Zfp280d APN 9 72335074 missense probably damaging 1.00
IGL02931:Zfp280d APN 9 72296025 missense probably benign 0.02
IGL03076:Zfp280d APN 9 72312662 missense probably damaging 0.99
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0288:Zfp280d UTSW 9 72331339 nonsense probably null
R0419:Zfp280d UTSW 9 72312237 missense probably benign 0.02
R0540:Zfp280d UTSW 9 72307965 missense probably damaging 0.97
R0628:Zfp280d UTSW 9 72361948 missense probably benign
R0722:Zfp280d UTSW 9 72312101 missense possibly damaging 0.63
R1786:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R1826:Zfp280d UTSW 9 72298780 missense probably damaging 1.00
R1962:Zfp280d UTSW 9 72335080 nonsense probably null
R2130:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2132:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2133:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2143:Zfp280d UTSW 9 72312729 missense probably damaging 1.00
R2162:Zfp280d UTSW 9 72298822 missense probably damaging 1.00
R2266:Zfp280d UTSW 9 72301770 splice site probably benign
R2269:Zfp280d UTSW 9 72301770 splice site probably benign
R2278:Zfp280d UTSW 9 72338773 nonsense probably null
R2850:Zfp280d UTSW 9 72312089 missense probably benign 0.06
R3780:Zfp280d UTSW 9 72322524 missense probably damaging 1.00
R3950:Zfp280d UTSW 9 72296019 missense possibly damaging 0.49
R4330:Zfp280d UTSW 9 72295979 missense possibly damaging 0.86
R4716:Zfp280d UTSW 9 72312665 missense possibly damaging 0.94
R4876:Zfp280d UTSW 9 72298858 splice site probably benign
R4909:Zfp280d UTSW 9 72331432 missense probably damaging 1.00
R5214:Zfp280d UTSW 9 72308113 unclassified probably benign
R5518:Zfp280d UTSW 9 72324135 missense probably damaging 0.99
R5853:Zfp280d UTSW 9 72330942 missense probably benign 0.20
R5945:Zfp280d UTSW 9 72362332 nonsense probably null
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R7043:Zfp280d UTSW 9 72319257 missense probably damaging 1.00
R7501:Zfp280d UTSW 9 72361942 missense possibly damaging 0.65
R7658:Zfp280d UTSW 9 72324072 missense probably damaging 1.00
R7667:Zfp280d UTSW 9 72301965 missense probably damaging 1.00
R7792:Zfp280d UTSW 9 72331319 missense probably damaging 1.00
R7826:Zfp280d UTSW 9 72312671 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACCAGGTCTTTAAGCACTTGGCTTATAAAT -3'
(R):5'- GGAATACATCCAACACAGAACTCAAAACAC -3'

Sequencing Primer
(F):5'- ccagtgaccatttcttcaacc -3'
(R):5'- CAGAACTCAAAACACGCTTTTC -3'
Posted On2014-01-05