Incidental Mutation 'R1056:C7'
ID94402
Institutional Source Beutler Lab
Gene Symbol C7
Ensembl Gene ENSMUSG00000079105
Gene Namecomplement component 7
SynonymsLOC383055
MMRRC Submission 039146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1056 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location4988762-5063740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5045778 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 144 (N144S)
Ref Sequence ENSEMBL: ENSMUSP00000106317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110689
AA Change: N144S

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106317
Gene: ENSMUSG00000079105
AA Change: N144S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 30 80 1.95e-7 SMART
LDLa 84 121 6.53e-9 SMART
MACPF 248 450 9.45e-51 SMART
TSP1 503 551 1.62e-4 SMART
CCP 571 626 1.84e-9 SMART
CCP 631 688 2.23e-8 SMART
FIMAC 699 766 1.63e-24 SMART
FIMAC 773 841 4.65e-20 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serum glycoprotein that forms a membrane attack complex together with complement components C5b, C6, C8, and C9 as part of the terminal complement pathway of the innate immune system. The protein encoded by this gene contains a cholesterol-dependent cytolysin/membrane attack complex/perforin-like (CDC/MACPF) domain and belongs to a large family of structurally related molecules that form pores involved in host immunity and bacterial pathogenesis. This protein initiates membrane attack complex formation by binding the C5b-C6 subcomplex and inserts into the phospholipid bilayer, serving as a membrane anchor. Mutations in this gene are associated with a rare disorder called C7 deficiency. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,983,453 H2469N possibly damaging Het
4932438A13Rik T A 3: 37,044,680 M1152K probably benign Het
Abca14 A G 7: 120,325,072 Y1649C probably damaging Het
Abcc10 A C 17: 46,303,954 C1459W possibly damaging Het
Amfr A T 8: 93,985,469 F278I probably benign Het
Anks1b G T 10: 90,921,429 probably null Het
Bak1 A G 17: 27,021,273 S147P possibly damaging Het
Casd1 T C 6: 4,641,967 V748A probably benign Het
Ccdc180 T C 4: 45,916,375 S859P probably benign Het
Ccne2 T C 4: 11,192,707 S2P probably damaging Het
Cdc42bpg T A 19: 6,314,021 I541N probably benign Het
Cgnl1 T A 9: 71,725,895 N58I probably damaging Het
Chd7 T C 4: 8,822,402 S832P possibly damaging Het
Chl1 A T 6: 103,675,077 Y318F possibly damaging Het
Coq2 G T 5: 100,657,947 N274K probably benign Het
Crhr2 A T 6: 55,100,735 V214E probably damaging Het
Dgkg G C 16: 22,600,541 P70A probably damaging Het
Dync2h1 T C 9: 7,147,731 I966M probably benign Het
Eif5b C G 1: 38,022,167 R380G unknown Het
Fat4 T A 3: 38,891,392 I1478N probably damaging Het
Gm8251 C T 1: 44,060,927 G337D probably damaging Het
Impact A T 18: 12,976,524 I92L probably benign Het
Ly6c2 A G 15: 75,111,596 probably null Het
Lypd6b G A 2: 49,947,456 V147I possibly damaging Het
Mdga2 T C 12: 66,723,120 D192G probably damaging Het
Mms22l T C 4: 24,586,344 probably null Het
Myo9a C T 9: 59,832,201 T732I possibly damaging Het
Myrf C T 19: 10,223,486 M274I probably benign Het
Nfx1 G A 4: 41,003,057 R686Q probably damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr43 C T 11: 74,206,782 V145I probably benign Het
Olfr594 A T 7: 103,220,418 E233D probably benign Het
Oog4 T C 4: 143,438,011 T245A possibly damaging Het
Pclo A T 5: 14,540,055 K790* probably null Het
Pcm1 A G 8: 41,321,900 E1668G probably damaging Het
Pkhd1l1 T A 15: 44,591,964 N4040K probably damaging Het
Podnl1 T A 8: 84,129,276 S222T probably benign Het
Ppil4 A G 10: 7,799,632 T182A possibly damaging Het
Prdm13 T C 4: 21,678,544 K649E probably damaging Het
Prob1 A T 18: 35,653,610 H530Q probably benign Het
Rbbp4 A T 4: 129,317,649 M404K probably damaging Het
Rilpl1 A T 5: 124,493,837 F149I probably damaging Het
Sema6c T A 3: 95,171,216 S543T probably benign Het
Sh3rf3 G T 10: 59,007,082 W290L probably damaging Het
Slc2a12 T G 10: 22,665,451 S402A probably benign Het
Tas2r131 T A 6: 132,957,067 I260F possibly damaging Het
Tasp1 A G 2: 140,008,764 I113T possibly damaging Het
Tnrc18 G A 5: 142,773,859 R741* probably null Het
Ube2o G T 11: 116,546,464 D244E probably damaging Het
Vmn1r206 A T 13: 22,620,614 M141K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp747 A G 7: 127,374,588 S137P probably benign Het
Zfp951 A T 5: 104,815,285 H138Q possibly damaging Het
Other mutations in C7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:C7 APN 15 5059389 splice site probably benign
IGL02803:C7 APN 15 5049560 missense probably damaging 1.00
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0271:C7 UTSW 15 5015380 missense possibly damaging 0.81
R0360:C7 UTSW 15 4988962 missense probably benign 0.00
R0433:C7 UTSW 15 4988916 missense probably damaging 1.00
R0505:C7 UTSW 15 4994142 splice site probably benign
R1443:C7 UTSW 15 5059419 missense probably benign 0.01
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1700:C7 UTSW 15 5002792 nonsense probably null
R1774:C7 UTSW 15 5012075 missense probably damaging 0.99
R1801:C7 UTSW 15 5012021 missense possibly damaging 0.61
R1809:C7 UTSW 15 5034339 missense probably damaging 0.99
R1986:C7 UTSW 15 5012012 missense possibly damaging 0.94
R2037:C7 UTSW 15 5034238 nonsense probably null
R2047:C7 UTSW 15 5045661 missense probably damaging 1.00
R2073:C7 UTSW 15 4990428 missense probably benign 0.09
R3972:C7 UTSW 15 5007651 missense possibly damaging 0.77
R4080:C7 UTSW 15 4990464 missense probably benign 0.09
R4200:C7 UTSW 15 4990309 critical splice donor site probably null
R4576:C7 UTSW 15 5002756 missense probably damaging 1.00
R4815:C7 UTSW 15 5059405 missense probably benign 0.16
R4995:C7 UTSW 15 5049592 missense probably damaging 1.00
R5300:C7 UTSW 15 5031950 missense probably damaging 1.00
R5562:C7 UTSW 15 5031915 nonsense probably null
R5708:C7 UTSW 15 5015401 missense possibly damaging 0.90
R5740:C7 UTSW 15 5057040 missense probably benign 0.00
R5873:C7 UTSW 15 5005235 missense probably damaging 1.00
R6222:C7 UTSW 15 5011941 missense possibly damaging 0.89
R6516:C7 UTSW 15 5057081 missense probably damaging 0.98
R6810:C7 UTSW 15 5007654 missense probably damaging 0.98
R7019:C7 UTSW 15 5045682 missense probably benign 0.04
R7199:C7 UTSW 15 4994243 missense probably benign 0.09
R7276:C7 UTSW 15 5011967 missense probably damaging 1.00
R7422:C7 UTSW 15 5012056 missense probably benign 0.13
R7652:C7 UTSW 15 5012105 missense probably damaging 1.00
R7783:C7 UTSW 15 5007710 missense probably benign 0.08
Z1177:C7 UTSW 15 5015375 missense not run
Predicted Primers PCR Primer
(F):5'- CATCCGAGGAGTAGAAGTTTGGTGC -3'
(R):5'- CGTGGCTTCCCAGGTGGTAAAATG -3'

Sequencing Primer
(F):5'- AACAGGTGCAGCCATTTTG -3'
(R):5'- TTCCCAGGTGGTAAAATGTAGAAG -3'
Posted On2014-01-05