Incidental Mutation 'R3972:C7'
ID311038
Institutional Source Beutler Lab
Gene Symbol C7
Ensembl Gene ENSMUSG00000079105
Gene Namecomplement component 7
SynonymsLOC383055
MMRRC Submission 040840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3972 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location4988762-5063740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5007651 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 582 (V582I)
Ref Sequence ENSEMBL: ENSMUSP00000106317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110689
AA Change: V582I

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106317
Gene: ENSMUSG00000079105
AA Change: V582I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 30 80 1.95e-7 SMART
LDLa 84 121 6.53e-9 SMART
MACPF 248 450 9.45e-51 SMART
TSP1 503 551 1.62e-4 SMART
CCP 571 626 1.84e-9 SMART
CCP 631 688 2.23e-8 SMART
FIMAC 699 766 1.63e-24 SMART
FIMAC 773 841 4.65e-20 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serum glycoprotein that forms a membrane attack complex together with complement components C5b, C6, C8, and C9 as part of the terminal complement pathway of the innate immune system. The protein encoded by this gene contains a cholesterol-dependent cytolysin/membrane attack complex/perforin-like (CDC/MACPF) domain and belongs to a large family of structurally related molecules that form pores involved in host immunity and bacterial pathogenesis. This protein initiates membrane attack complex formation by binding the C5b-C6 subcomplex and inserts into the phospholipid bilayer, serving as a membrane anchor. Mutations in this gene are associated with a rare disorder called C7 deficiency. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T G 17: 71,985,447 D512A probably benign Het
Avl9 T C 6: 56,743,408 F477S probably damaging Het
Cldn20 A G 17: 3,532,639 N29S probably benign Het
Coro2b C T 9: 62,429,240 A251T possibly damaging Het
Dnah3 T A 7: 120,086,720 D131V probably damaging Het
Dusp12 T C 1: 170,879,775 K248R probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fgf1 T C 18: 38,847,094 T76A probably benign Het
Gucy2c C T 6: 136,708,366 R859K probably damaging Het
Irf2bp1 T A 7: 19,005,444 D336E possibly damaging Het
Lpar6 A G 14: 73,239,073 H158R probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Lyst T C 13: 13,706,625 C2814R possibly damaging Het
Man2b1 A G 8: 85,085,391 N158S probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mrpl16 A G 19: 11,772,875 N41S probably benign Het
Myo5b C T 18: 74,740,527 L1501F probably damaging Het
Nudt9 G T 5: 104,047,125 C29F probably benign Het
Olfr1423 G T 19: 12,036,019 T241N probably damaging Het
Otop1 A G 5: 38,300,189 I431V probably benign Het
Otp T G 13: 94,883,184 L181R probably damaging Het
Pde4a A G 9: 21,206,217 T592A probably damaging Het
Pi4ka A G 16: 17,293,875 Y1579H probably damaging Het
Rb1cc1 T C 1: 6,249,000 V864A probably benign Het
Reln A T 5: 21,979,001 F1667I probably damaging Het
Serpinb10 T A 1: 107,536,122 F45I probably damaging Het
Setdb1 A T 3: 95,341,338 N422K probably damaging Het
Slc17a7 A G 7: 45,169,910 I137V possibly damaging Het
Tet1 T A 10: 62,813,726 E67D probably damaging Het
Tpcn1 C A 5: 120,553,752 probably null Het
Trav9-4 T C 14: 53,676,420 Y44H possibly damaging Het
Trmt1l A G 1: 151,433,883 N106D possibly damaging Het
Ttll12 A T 15: 83,582,096 L388Q probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubfd1 T G 7: 122,067,433 S51A probably benign Het
Uckl1 T C 2: 181,574,463 D148G probably damaging Het
Usp34 T C 11: 23,457,803 L2571S probably damaging Het
Wdr75 T C 1: 45,822,554 V718A probably benign Het
Zfp266 A G 9: 20,500,150 S244P probably damaging Het
Zfp979 G A 4: 147,618,419 Q25* probably null Het
Other mutations in C7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:C7 APN 15 5059389 splice site probably benign
IGL02803:C7 APN 15 5049560 missense probably damaging 1.00
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0271:C7 UTSW 15 5015380 missense possibly damaging 0.81
R0360:C7 UTSW 15 4988962 missense probably benign 0.00
R0433:C7 UTSW 15 4988916 missense probably damaging 1.00
R0505:C7 UTSW 15 4994142 splice site probably benign
R1056:C7 UTSW 15 5045778 missense possibly damaging 0.89
R1443:C7 UTSW 15 5059419 missense probably benign 0.01
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1700:C7 UTSW 15 5002792 nonsense probably null
R1774:C7 UTSW 15 5012075 missense probably damaging 0.99
R1801:C7 UTSW 15 5012021 missense possibly damaging 0.61
R1809:C7 UTSW 15 5034339 missense probably damaging 0.99
R1986:C7 UTSW 15 5012012 missense possibly damaging 0.94
R2037:C7 UTSW 15 5034238 nonsense probably null
R2047:C7 UTSW 15 5045661 missense probably damaging 1.00
R2073:C7 UTSW 15 4990428 missense probably benign 0.09
R4080:C7 UTSW 15 4990464 missense probably benign 0.09
R4200:C7 UTSW 15 4990309 critical splice donor site probably null
R4576:C7 UTSW 15 5002756 missense probably damaging 1.00
R4815:C7 UTSW 15 5059405 missense probably benign 0.16
R4995:C7 UTSW 15 5049592 missense probably damaging 1.00
R5300:C7 UTSW 15 5031950 missense probably damaging 1.00
R5562:C7 UTSW 15 5031915 nonsense probably null
R5708:C7 UTSW 15 5015401 missense possibly damaging 0.90
R5740:C7 UTSW 15 5057040 missense probably benign 0.00
R5873:C7 UTSW 15 5005235 missense probably damaging 1.00
R6222:C7 UTSW 15 5011941 missense possibly damaging 0.89
R6516:C7 UTSW 15 5057081 missense probably damaging 0.98
R6810:C7 UTSW 15 5007654 missense probably damaging 0.98
R7019:C7 UTSW 15 5045682 missense probably benign 0.04
R7199:C7 UTSW 15 4994243 missense probably benign 0.09
R7276:C7 UTSW 15 5011967 missense probably damaging 1.00
R7422:C7 UTSW 15 5012056 missense probably benign 0.13
R7652:C7 UTSW 15 5012105 missense probably damaging 1.00
R7783:C7 UTSW 15 5007710 missense probably benign 0.08
R8266:C7 UTSW 15 5007659 missense probably damaging 0.99
R8295:C7 UTSW 15 4988845 missense probably damaging 1.00
Z1177:C7 UTSW 15 5015375 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGACTTCTCATTCCATAGAAGGAC -3'
(R):5'- TGCGTCACCCAAAGATATTCATC -3'

Sequencing Primer
(F):5'- CTCATTCCATAGAAGGACTGATGAAG -3'
(R):5'- GATCACATATTGGTTCTGTGAAAGAC -3'
Posted On2015-04-29