Incidental Mutation 'R1016:Pvr'
ID96305
Institutional Source Beutler Lab
Gene Symbol Pvr
Ensembl Gene ENSMUSG00000040511
Gene Namepoliovirus receptor
SynonymsCD155, D7Ertd458e, mE4, necl-5, Taa1, Tage4
MMRRC Submission 039120-MU
Accession Numbers

Genbank: NM_027514 ; MGI: 107741

Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19903578-19921160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19909217 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 364 (I364V)
Ref Sequence ENSEMBL: ENSMUSP00000039205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043517]
Predicted Effect probably benign
Transcript: ENSMUST00000043517
AA Change: I364V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039205
Gene: ENSMUSG00000040511
AA Change: I364V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 35 142 1.58e-10 SMART
Pfam:C2-set_2 145 231 2e-18 PFAM
Pfam:C1-set 160 233 1.3e-5 PFAM
IG_like 254 334 6.75e1 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208861
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele have a reduced antibody response to oral immunization. Mice homozygous for a different null allele exhibit reduced susceptibility to chemically induced colon cancer. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Pvr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Pvr APN 7 19914859 missense probably damaging 1.00
IGL01700:Pvr APN 7 19909232 missense probably benign 0.11
IGL02536:Pvr APN 7 19918792 missense probably benign 0.17
F2404:Pvr UTSW 7 19905177 missense probably benign 0.06
R1470:Pvr UTSW 7 19918624 missense possibly damaging 0.51
R1470:Pvr UTSW 7 19918624 missense possibly damaging 0.51
R1525:Pvr UTSW 7 19910626 nonsense probably null
R2138:Pvr UTSW 7 19917002 missense probably damaging 1.00
R3912:Pvr UTSW 7 19909292 missense probably benign 0.01
R6667:Pvr UTSW 7 19905802 missense probably benign 0.07
R6724:Pvr UTSW 7 19918679 missense possibly damaging 0.95
R6855:Pvr UTSW 7 19909214 missense possibly damaging 0.92
R6866:Pvr UTSW 7 19918630 missense probably benign 0.01
R7030:Pvr UTSW 7 19905180 missense possibly damaging 0.84
R7158:Pvr UTSW 7 19918637 nonsense probably null
R7352:Pvr UTSW 7 19910616 missense possibly damaging 0.81
X0025:Pvr UTSW 7 19910652 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AAGACTCCCTGGCTGTACCGTG -3'
(R):5'- AGGGATGCACACCTCTCGACAC -3'

Sequencing Primer
(F):5'- GGCTGTACCGTGGATGC -3'
(R):5'- gggagacagacagggagg -3'
Posted On2014-01-05