Incidental Mutation 'R1022:Sirt5'
ID 98799
Institutional Source Beutler Lab
Gene Symbol Sirt5
Ensembl Gene ENSMUSG00000054021
Gene Name sirtuin 5
Synonyms 0610012J09Rik, 1500032M05Rik
MMRRC Submission 039124-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1022 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 43518972-43548679 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43524245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 6 (I6V)
Ref Sequence ENSEMBL: ENSMUSP00000152760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066804] [ENSMUST00000220458] [ENSMUST00000220576] [ENSMUST00000220645] [ENSMUST00000221481] [ENSMUST00000221515] [ENSMUST00000223194]
AlphaFold Q8K2C6
Predicted Effect probably benign
Transcript: ENSMUST00000066804
AA Change: I6V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071048
Gene: ENSMUSG00000054021
AA Change: I6V

DomainStartEndE-ValueType
Pfam:SIR2 58 256 5.3e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220458
AA Change: I6V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000220576
AA Change: I6V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000220645
AA Change: I6V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220874
Predicted Effect probably benign
Transcript: ENSMUST00000221481
AA Change: I6V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000221515
AA Change: I6V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000223194
AA Change: I6V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222489
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly healthy and do not exhibit globally increased mitochondrial protein acetylation levels relative to wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,096,466 (GRCm39) N425K probably benign Het
Ccar2 A G 14: 70,377,964 (GRCm39) S674P probably damaging Het
Cdc14b A T 13: 64,363,490 (GRCm39) V257E probably damaging Het
Cfap100 T A 6: 90,389,986 (GRCm39) T101S possibly damaging Het
Dock6 A T 9: 21,744,908 (GRCm39) L556H probably damaging Het
Dqx1 G A 6: 83,038,070 (GRCm39) C486Y probably damaging Het
Drd1 T A 13: 54,207,333 (GRCm39) M294L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Fcho2 A T 13: 98,869,167 (GRCm39) I568N probably damaging Het
Folr1 A G 7: 101,507,810 (GRCm39) M210T probably damaging Het
Gatc T A 5: 115,478,904 (GRCm39) probably null Het
H1f7 G A 15: 98,154,636 (GRCm39) T171I unknown Het
Hnrnpd C A 5: 100,114,016 (GRCm39) *87L probably null Het
Hpd C T 5: 123,312,532 (GRCm39) R279H possibly damaging Het
Igfals G A 17: 25,099,457 (GRCm39) V183M probably damaging Het
Marchf2 C A 17: 33,928,762 (GRCm39) G45C probably damaging Het
Myo15a A T 11: 60,370,442 (GRCm39) R1067S probably benign Het
Nell1 A G 7: 49,770,411 (GRCm39) S157G probably damaging Het
Nf1 A T 11: 79,437,859 (GRCm39) E2072D probably damaging Het
Nop2 T A 6: 125,114,149 (GRCm39) V205E probably benign Het
Nudt8 T A 19: 4,051,925 (GRCm39) W179R probably damaging Het
Or4k5 A T 14: 50,385,384 (GRCm39) F316I probably benign Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,896,729 (GRCm39) probably benign Het
Prl5a1 G A 13: 28,333,880 (GRCm39) V128I probably damaging Het
Pth1r A T 9: 110,571,295 (GRCm39) L25Q probably damaging Het
Pth1r T C 9: 110,558,689 (GRCm39) D96G probably benign Het
Rwdd2b A T 16: 87,233,738 (GRCm39) C121S probably damaging Het
Scn10a A G 9: 119,438,340 (GRCm39) I1843T probably damaging Het
Slc5a3 G A 16: 91,874,383 (GRCm39) A147T probably damaging Het
Stxbp1 T C 2: 32,704,979 (GRCm39) probably null Het
Syt3 G T 7: 44,040,106 (GRCm39) G113V probably damaging Het
Tatdn2 A G 6: 113,686,506 (GRCm39) T644A probably damaging Het
Trim9 T A 12: 70,298,791 (GRCm39) probably null Het
Tut1 A G 19: 8,936,719 (GRCm39) N181S probably benign Het
Vmn2r90 A T 17: 17,948,400 (GRCm39) I549F probably damaging Het
Other mutations in Sirt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Sirt5 APN 13 43,533,164 (GRCm39) missense probably damaging 1.00
R0584:Sirt5 UTSW 13 43,548,204 (GRCm39) splice site probably null
R0697:Sirt5 UTSW 13 43,539,052 (GRCm39) missense probably damaging 1.00
R1024:Sirt5 UTSW 13 43,524,245 (GRCm39) missense probably benign 0.05
R1352:Sirt5 UTSW 13 43,548,283 (GRCm39) missense probably damaging 1.00
R1874:Sirt5 UTSW 13 43,524,267 (GRCm39) missense possibly damaging 0.92
R3552:Sirt5 UTSW 13 43,536,643 (GRCm39) missense probably damaging 1.00
R3778:Sirt5 UTSW 13 43,536,583 (GRCm39) critical splice acceptor site probably null
R5591:Sirt5 UTSW 13 43,525,317 (GRCm39) missense possibly damaging 0.67
R7188:Sirt5 UTSW 13 43,525,380 (GRCm39) missense possibly damaging 0.93
R7788:Sirt5 UTSW 13 43,536,623 (GRCm39) missense probably benign 0.43
R8063:Sirt5 UTSW 13 43,524,323 (GRCm39) missense probably benign 0.00
R8347:Sirt5 UTSW 13 43,533,977 (GRCm39) missense probably benign 0.00
R8859:Sirt5 UTSW 13 43,524,327 (GRCm39) missense possibly damaging 0.75
R9339:Sirt5 UTSW 13 43,530,327 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGACTTCACCCATCTCCAAATGC -3'
(R):5'- GGAAATCACGCTAAAGCCCTCTCAG -3'

Sequencing Primer
(F):5'- gggaggaacattattcaacactac -3'
(R):5'- TAAAGCCCTCTCAGCACCG -3'
Posted On 2014-01-09