Incidental Mutation 'R1217:Ash2l'
ID99745
Institutional Source Beutler Lab
Gene Symbol Ash2l
Ensembl Gene ENSMUSG00000031575
Gene NameASH2 like histone lysine methyltransferase complex subunit
Synonyms
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1217 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25815996-25847694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25822885 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 441 (N441S)
Ref Sequence ENSEMBL: ENSMUSP00000070957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068892] [ENSMUST00000110608] [ENSMUST00000110609] [ENSMUST00000110610] [ENSMUST00000139946] [ENSMUST00000151856] [ENSMUST00000166078]
Predicted Effect probably damaging
Transcript: ENSMUST00000068892
AA Change: N441S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070957
Gene: ENSMUSG00000031575
AA Change: N441S

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-136 PDB
Blast:PHD 103 146 2e-6 BLAST
low complexity region 280 306 N/A INTRINSIC
SPRY 413 577 4.87e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110608
AA Change: N352S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106238
Gene: ENSMUSG00000031575
AA Change: N352S

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 455 1.13e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110609
AA Change: N352S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106239
Gene: ENSMUSG00000031575
AA Change: N352S

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110610
AA Change: N352S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106240
Gene: ENSMUSG00000031575
AA Change: N352S

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139946
SMART Domains Protein: ENSMUSP00000118346
Gene: ENSMUSG00000031575

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-141 PDB
Blast:PHD 103 146 1e-6 BLAST
transmembrane domain 278 300 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149550
Predicted Effect probably benign
Transcript: ENSMUST00000151856
SMART Domains Protein: ENSMUSP00000117488
Gene: ENSMUSG00000031575

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 272 1e-125 PDB
Blast:PHD 103 146 1e-6 BLAST
transmembrane domain 286 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156759
Predicted Effect possibly damaging
Transcript: ENSMUST00000166078
AA Change: N352S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132546
Gene: ENSMUSG00000031575
AA Change: N352S

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Meta Mutation Damage Score 0.1154 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele die before E8.5-E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Ccp110 T C 7: 118,729,944 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cfap57 A G 4: 118,606,652 S335P possibly damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Cyth3 T C 5: 143,702,820 Y240H probably damaging Het
Dhx9 G A 1: 153,458,363 T1017I probably damaging Het
Edar T C 10: 58,628,631 Y62C probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Lmx1a G A 1: 167,791,399 R109H probably damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Myo3b A C 2: 70,330,880 E1128A probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Rimbp2 C T 5: 128,788,287 A666T probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Tprg T C 16: 25,412,843 S190P probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Ash2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Ash2l APN 8 25839840 missense probably damaging 1.00
IGL01913:Ash2l APN 8 25819624 critical splice donor site probably null
IGL02379:Ash2l APN 8 25822771 missense probably damaging 1.00
IGL03149:Ash2l APN 8 25818622 missense probably benign 0.00
R0639:Ash2l UTSW 8 25823291 missense possibly damaging 0.83
R1244:Ash2l UTSW 8 25817421 missense probably damaging 0.99
R1440:Ash2l UTSW 8 25827378 missense probably benign 0.27
R2282:Ash2l UTSW 8 25835042 missense probably damaging 0.99
R3013:Ash2l UTSW 8 25839764 missense probably damaging 0.96
R3721:Ash2l UTSW 8 25818625 missense probably damaging 1.00
R4155:Ash2l UTSW 8 25817454 missense probably damaging 1.00
R4727:Ash2l UTSW 8 25818595 missense probably damaging 0.99
R5637:Ash2l UTSW 8 25827311 missense probably damaging 1.00
R5973:Ash2l UTSW 8 25817614 missense possibly damaging 0.93
R6473:Ash2l UTSW 8 25834980 missense probably damaging 0.98
R6678:Ash2l UTSW 8 25833777 missense probably damaging 1.00
R6710:Ash2l UTSW 8 25819712 missense possibly damaging 0.63
R6954:Ash2l UTSW 8 25822768 missense possibly damaging 0.52
R7166:Ash2l UTSW 8 25827320 missense probably damaging 1.00
R7266:Ash2l UTSW 8 25827205 nonsense probably null
R7483:Ash2l UTSW 8 25822770 missense probably damaging 1.00
R7828:Ash2l UTSW 8 25823186 missense possibly damaging 0.91
R8084:Ash2l UTSW 8 25831294 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGCAACATCTAGGGGCACTGAC -3'
(R):5'- ATGGGCTTGAGGTTTACCAGCG -3'

Sequencing Primer
(F):5'- TGCAGCTACAGTGCCTG -3'
(R):5'- AGGTTTACCAGCGCATGGTC -3'
Posted On2014-01-15