Phenotypic Mutation 'May' (pdf version)
List |< first << previous [record 90 of 132] next >> last >|
AlleleMay
Mutation Type nonsense
Chromosome5
Coordinate140,876,495 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Card11
Gene Name caspase recruitment domain family, member 11
Synonym(s) CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Chromosomal Location 140,872,990-141,000,582 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_175362; MGI: 1916978

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: R1016*

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All alleles(10) : Targeted(7) Gene trapped(1) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 missense probably damaging 1.00
IGL00961:Card11 APN 5 140899709 missense probably damaging 0.97
IGL01645:Card11 APN 5 140878023 missense probably benign 0.00
IGL01731:Card11 APN 5 140882302 missense possibly damaging 0.89
IGL01782:Card11 APN 5 140927726 start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140883546 missense possibly damaging 0.62
IGL01991:Card11 APN 5 140913378 missense possibly damaging 0.63
IGL02447:Card11 APN 5 140906924 missense possibly damaging 0.93
IGL02583:Card11 APN 5 140878126 missense probably benign 0.10
IGL03255:Card11 APN 5 140898331 missense possibly damaging 0.73
Dealer UTSW 5 140885877 missense probably damaging 1.00
hubei UTSW 5 140906767 missense probably damaging 0.98
king UTSW 5 140891080 missense probably benign 0.02
Tumnus UTSW 5 140885945 missense possibly damaging 0.75
unmodulated2 UTSW 5 140883782 intron probably null
R0046:Card11 UTSW 5 140908524 missense possibly damaging 0.92
R0285:Card11 UTSW 5 140887101 missense probably damaging 1.00
R0452:Card11 UTSW 5 140880370 missense probably benign 0.01
R1486:Card11 UTSW 5 140876519 missense probably benign
R1710:Card11 UTSW 5 140902905 nonsense probably null
R1733:Card11 UTSW 5 140906633 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140885560 missense probably benign 0.00
R1818:Card11 UTSW 5 140885560 missense probably benign 0.00
R2027:Card11 UTSW 5 140906767 missense probably damaging 0.96
R2436:Card11 UTSW 5 140882362 missense possibly damaging 0.89
R2904:Card11 UTSW 5 140889133 missense probably benign 0.09
R3706:Card11 UTSW 5 140887135 missense probably damaging 0.99
R3708:Card11 UTSW 5 140887135 missense probably damaging 0.99
R4778:Card11 UTSW 5 140883782 splice site probably null
R4877:Card11 UTSW 5 140885877 missense probably damaging 1.00
R4889:Card11 UTSW 5 140885945 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140874414 missense probably damaging 1.00
R5011:Card11 UTSW 5 140876520 missense possibly damaging 0.93
R5257:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140902911 nonsense probably null
R5754:Card11 UTSW 5 140899769 missense probably damaging 0.99
R5873:Card11 UTSW 5 140908638 missense probably damaging 1.00
R6184:Card11 UTSW 5 140898278 missense probably damaging 1.00
R6792:Card11 UTSW 5 140913309 missense probably damaging 1.00
R6825:Card11 UTSW 5 140878082 missense probably benign
V7732:Card11 UTSW 5 140876495 nonsense probably null
X0067:Card11 UTSW 5 140885592 missense possibly damaging 0.60
Mode of Inheritance Autosomal Dominant
Local Stock Live Mice, Sperm
MMRRC Submission 036966-MU
Last Updated 2017-09-08 4:04 PM by Diantha La Vine
Record Created 2011-01-30 2:13 PM by Carrie N. Arnold
Record Posted 2013-07-23
Other Mutations in This Stock Stock #: V7732 Run Code: HSQ01006
Coding Region Coverage: 10x: 94.9% 20x: 90.3%
Validation Efficiency: 25/26

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
Adcy5 T to C 16: 35,283,541 F793L probably benign Het
Atmin C to T 8: 116,956,479 P293S probably damaging Het
Card11 G to A 5: 140,876,495 R1016* probably null Het
Cep89 A to G 7: 35,403,098 S79G probably damaging Het
Cic T to C 7: 25,292,245 V2227A probably benign Het
Clcn6 A to G 4: 148,013,955 V534A probably damaging Het
Dpep2 T to A 8: 105,989,260 H124L probably damaging Het
Elfn1 G to A 5: 139,971,439 R66Q probably damaging Het
Fanca G to A 8: 123,304,281 probably benign Het
Ggh T to A 4: 20,046,225 F44L probably benign Het
Gpr37 T to C 6: 25,669,123 Y574C probably benign Het
Heatr5a C to A 12: 51,905,324 A1178S possibly damaging Het
Igsf9 A to G 1: 172,490,393 T106A probably benign Het
Itpr3 G to T 17: 27,111,024 probably benign Het
Itpr3 G to C 17: 27,111,026 probably null Het
Nlrp6 G to A 7: 140,926,648 probably benign Het
Rabac1 T to A 7: 24,972,219 Q51L probably damaging Het
Rgma A to G 7: 73,417,320 T108A probably damaging Het
Rps24 A to G 14: 24,491,762 T6A probably damaging Het
Sarm1 T to A 11: 78,488,065 T385S probably benign Het
Spata17 T to C 1: 187,048,480 T357A possibly damaging Het
Ufl1 T to C 4: 25,251,368 I711V probably damaging Het
Vwa3a A to G 7: 120,778,949 probably benign Het
Phenotypic Description
Figure 1. May mice mice have low T-independent IgM responses (left), but normal T-dependent IgG responses (right).

The May phenotype was identified among ENU-mutagenized G3 mice in a screen for mutations impair T-independent B cell responsesMay mice mice have low T-independent IgM responses 5 days after immunization with NP-Ficoll (Figure 1, left), but normal T-dependent IgG responses 14 days after immunization with a recombinant SFV vector encoding the model antigen, β-galactosidase (βGal) (Figure 1, right). May B cells express high surface levels of IgM.

Nature of Mutation

The May strain was regenerated by intracytoplasmic sperm injection (ICSI) of cryopreserved sperm from an affected homozygote into C57BL/6J oocytes. Whole exome HiSeq sequencing of one of the resulting mice, an affected female, identified 26 mutations. Based on initial genotyping of the 26 mutation sites in one affected and three unaffected mice, five candidate genes (Ggh, 1810074P20Rik, Card11, Fanca, Rps24) were identified because they were homozygous for the reference sequence in all unaffected mice and heterozygous for the mutant allele in the affected mouse.  Subsequent analysis of nine additional affected mice and two unaffected mice provided strongest support for a Card11 mutation as causal for the May phenotype; bulk segregation analysis (BSA) also indicated that the mutation in Card11 was causative. The mutation is a C to T transition at base pair 140876495 (v38) on Chromosome 5 in the GenBank genomic region NC_000071 encoding Card11. The mutation corresponds to residue 3367 in the mRNA sequence NM_175362 within exon 23 of 25 total exons.  Phenotypic inheritance pattern suggests that the May mutation is semi-dominant or dominant.

 

3352 AGAGATGAGTTCCTCCGAAAGCAGAAGACAGAG
1011 -R--D--E--F--L--R--K--Q--K--T--E-

 

The mutated nucleotide is indicated in red.  The mutation results in an arginine (R) to premature stop codon substitution at amino acid 1016.

Protein Prediction
Figure 2. Domain structure of CARMA1. The location of the May mutation, within the guanylate kinase (GUK) region, is indicated with a red asterisk. Four predicted α-helices are represented in pink. Click on the image to view other mutations found in CARMA1 (phenotypic, red; incidental, blue). Click on each mututation for more specific information.

The May mutation is an arginine to premature stop codon subsitition at position 1016 of CARMA1, the protein encoded by Card11. The CARMA1 protein has a membrane-associated guanylate kinase (MAGUK) domain at the C-terminus. MAGUK family proteins contain 3 modular protein interaction domains, of which the hallmark is an approximately 300 amino acid region with homology to yeast guanylate kinase (GUK), but which is catalytically inactive. In addition, up to three PDZ domains and an SH3 domain are always present in tandem with the guanylate kinase domain. The May mutation is within the GUK subdomain (amino acids 954-1142) (1;2). Protein expression in the May mice has not been examined.

 

Please see the record for king for more information about Card11.

Putative Mechanism

The phenotype of the May mice is similar to those observed in other CARMA1 mutants (3-6). For example, homozygous unmodulated mice displayed impaired IgM and IgG3 responses to immunization with DNP-Ficoll (7).  The IgM and IgG responses to the T-dependent antigen chicken γ globulin were reduced in unmodulated mice (7); this phenotype has not been tested in May animals. Taken together, these data strongly suggest that the May mutation causes a loss of function of the CARMA1 protein. As the May mutation is a late stop codon, it is possible that the protein product is mostly intact and capable of engaging its interaction partners in the CARMA1/BCL10/MALT1 complex, but dominantly inhibits complex function. Upon T cell receptor-mediated activation of the T cell, the CARMA1/BCL10/MALT1 complex is recruited to lipid rafts of the immunological synapse and activates the IKK complex, leading to the degradation of IκB and the subsequent activation of NF-κB (2;3;8-11). The CARMA1/BCL10/MALT1 complex functions similarly in B cells to activate NF-κB in response to BCR engagement (12).

Primers Primers cannot be located by automatic search.
Genotyping

May genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

PCR Primers

May(F): 5’- TGCATGGTCTGGCAGAGCAATC -3’

May(R): 5’- ATGACCCAGTGCCTCACAGAGATG -3’

 


Sequencing Primer

May_seq(F): 5’- GCCTCACAGAGATGGTTGG -3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 404 nucleotides (from Genbank genomic region NC_000071 for linear DNA sequence of Card11) is amplified:

 

123864                          tgcatgg tctggcagag caatcatgaa cttgacccca

123901 ctcccaggga gcttccctat ctagtagaga agatgatgtt ccatttaacc aaagtgggaa

123961 agaaccagat gaatatcaaa ttatgtggca cttaggaggg acagataggg cctggaagag

124021 acaacccacc acaaatagca cttgccaccc tgggcactaa ctcccctctc ttcagatatt

124081 gtcacaagag atgagttcct ccgaaagcag aagacagaga ccatcatcta ctcccgggaa

124141 aagaacccca acacctttga atgcatcgtc cctgccaaca ttgaggctgt ggcagccaag

124201 gtgagagacc ctgggtactg gccagactaa ggccctaccc aaccatctct gtgaggcact

124261 gggtcat

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated C is shown in red text.

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsCarrie Arnold and Elaine Pirie
List |< first << previous [record 90 of 132] next >> last >|