Incidental Mutation 'R7730:Card11'
ID 595760
Institutional Source Beutler Lab
Gene Symbol Card11
Ensembl Gene ENSMUSG00000036526
Gene Name caspase recruitment domain family, member 11
Synonyms 2410011D02Rik, BIMP3, CARMA1, 0610008L17Rik
MMRRC Submission 045786-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7730 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 140858745-140986337 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 140871751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 650 (R650L)
Ref Sequence ENSEMBL: ENSMUSP00000082941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085786]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000085786
AA Change: R650L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: R650L

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T A 11: 48,838,703 (GRCm39) H628L probably benign Het
Adam6a T A 12: 113,507,660 (GRCm39) V11E possibly damaging Het
Amotl1 T G 9: 14,467,059 (GRCm39) K660T possibly damaging Het
Ap4m1 T C 5: 138,171,077 (GRCm39) I59T probably damaging Het
Brd3 T C 2: 27,346,967 (GRCm39) Y389C probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cercam G A 2: 29,762,574 (GRCm39) probably null Het
Cnst T C 1: 179,452,650 (GRCm39) C673R probably damaging Het
Dld G T 12: 31,390,864 (GRCm39) T194K probably benign Het
Dnah12 T A 14: 26,507,890 (GRCm39) W1714R probably damaging Het
Dsg1a T G 18: 20,464,768 (GRCm39) V421G possibly damaging Het
Fer1l4 G T 2: 155,890,854 (GRCm39) P188Q probably benign Het
Gpr158 T C 2: 21,831,158 (GRCm39) S753P probably damaging Het
Hdc A T 2: 126,436,002 (GRCm39) M623K possibly damaging Het
Herc1 CAACCCTGGTAAC CAAC 9: 66,400,472 (GRCm39) probably benign Het
Igf2r A T 17: 12,954,878 (GRCm39) F203I probably damaging Het
Jag2 A T 12: 112,885,661 (GRCm39) I145N probably damaging Het
Kcnt2 T A 1: 140,446,686 (GRCm39) F694I probably benign Het
Lpl A T 8: 69,340,100 (GRCm39) R32* probably null Het
Mcpt4 T A 14: 56,297,428 (GRCm39) I243L probably benign Het
Mtf1 C A 4: 124,732,412 (GRCm39) A490E possibly damaging Het
Mycbp2 A T 14: 103,360,791 (GRCm39) M4497K probably damaging Het
Myog T C 1: 134,218,914 (GRCm39) probably null Het
Nav2 T C 7: 49,222,145 (GRCm39) S1757P probably damaging Het
Or7g18 T G 9: 18,786,709 (GRCm39) F26V probably benign Het
Osmr T A 15: 6,853,963 (GRCm39) I583F probably damaging Het
Phf19 T A 2: 34,785,816 (GRCm39) E551V probably damaging Het
Plxnb2 A G 15: 89,046,533 (GRCm39) M870T probably benign Het
Psat1 A G 19: 15,895,720 (GRCm39) F83L probably damaging Het
Reep1 T A 6: 71,757,725 (GRCm39) V108D possibly damaging Het
Rorc A G 3: 94,300,421 (GRCm39) T455A probably benign Het
Serinc5 T G 13: 92,821,698 (GRCm39) I169S probably damaging Het
Serpinb6c T C 13: 34,083,292 (GRCm39) M41V probably damaging Het
Sgsm3 A T 15: 80,892,927 (GRCm39) N335Y probably damaging Het
Slamf7 C T 1: 171,468,589 (GRCm39) R101H possibly damaging Het
Slc17a4 A T 13: 24,084,503 (GRCm39) L427* probably null Het
Slc35a5 T C 16: 44,964,246 (GRCm39) Q329R probably damaging Het
Slc45a1 C T 4: 150,715,397 (GRCm39) C656Y probably damaging Het
Srsf6 T C 2: 162,773,643 (GRCm39) I18T probably damaging Het
Syn3 T G 10: 86,284,773 (GRCm39) H109P probably benign Het
Synj2 T C 17: 6,066,562 (GRCm39) V580A probably benign Het
Tbc1d9b T C 11: 50,026,742 (GRCm39) V70A possibly damaging Het
Tc2n A G 12: 101,617,406 (GRCm39) Y402H probably damaging Het
Tmbim4 T C 10: 120,059,767 (GRCm39) C164R possibly damaging Het
Tnfrsf11b T A 15: 54,117,470 (GRCm39) R262* probably null Het
Tnip1 T C 11: 54,828,805 (GRCm39) K121E probably benign Het
Tut1 T C 19: 8,941,740 (GRCm39) probably null Het
Uhrf2 T A 19: 30,052,501 (GRCm39) C332S probably damaging Het
Vmn2r101 A G 17: 19,831,950 (GRCm39) I649V possibly damaging Het
Vwa8 A G 14: 79,232,589 (GRCm39) T644A probably benign Het
Zfhx2 T C 14: 55,304,357 (GRCm39) H1209R possibly damaging Het
Zfp384 A G 6: 125,008,635 (GRCm39) I306V probably benign Het
Zfp964 A G 8: 70,116,360 (GRCm39) E320G possibly damaging Het
Zmym2 A T 14: 57,193,638 (GRCm39) Y1151F possibly damaging Het
Other mutations in Card11
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140,897,997 (GRCm38) intron probably benign
IGL00961:Card11 APN 5 140,885,464 (GRCm39) missense probably damaging 0.97
IGL01645:Card11 APN 5 140,863,778 (GRCm39) missense probably benign 0.00
IGL01731:Card11 APN 5 140,868,057 (GRCm39) missense possibly damaging 0.89
IGL01782:Card11 APN 5 140,913,481 (GRCm39) start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140,869,301 (GRCm39) missense possibly damaging 0.62
IGL01991:Card11 APN 5 140,899,133 (GRCm39) missense possibly damaging 0.63
IGL02447:Card11 APN 5 140,892,679 (GRCm39) missense possibly damaging 0.93
IGL02583:Card11 APN 5 140,863,881 (GRCm39) missense probably benign 0.10
IGL03255:Card11 APN 5 140,884,086 (GRCm39) missense possibly damaging 0.73
Ace UTSW 5 140,888,632 (GRCm39) missense possibly damaging 0.70
Caravaggio UTSW 5 140,899,064 (GRCm39) missense probably damaging 1.00
Dealer UTSW 5 140,871,632 (GRCm39) missense probably damaging 1.00
Dogs UTSW 5 140,867,755 (GRCm39) critical splice donor site probably null
Face UTSW 5 140,886,732 (GRCm39) missense probably damaging 1.00
hubei UTSW 5 140,892,522 (GRCm39) missense probably damaging 0.96
king UTSW 5 140,876,835 (GRCm39) splice site probably benign
may UTSW 5 140,862,250 (GRCm39) nonsense probably null
Poker UTSW 5 140,863,837 (GRCm39) missense probably benign
Sharp UTSW 5 140,862,180 (GRCm39) missense possibly damaging 0.93
Tumnus UTSW 5 140,871,700 (GRCm39) missense possibly damaging 0.75
unmodulated2 UTSW 5 140,869,537 (GRCm39) splice site probably null
PIT4243001:Card11 UTSW 5 140,894,359 (GRCm39) missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140,862,163 (GRCm39) missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140,892,415 (GRCm39) missense probably damaging 0.99
R0046:Card11 UTSW 5 140,894,279 (GRCm39) missense possibly damaging 0.92
R0285:Card11 UTSW 5 140,872,856 (GRCm39) missense probably damaging 1.00
R0452:Card11 UTSW 5 140,866,125 (GRCm39) missense probably benign 0.01
R1486:Card11 UTSW 5 140,862,274 (GRCm39) missense probably benign
R1710:Card11 UTSW 5 140,888,660 (GRCm39) nonsense probably null
R1733:Card11 UTSW 5 140,892,388 (GRCm39) missense possibly damaging 0.88
R1817:Card11 UTSW 5 140,871,315 (GRCm39) missense probably benign 0.00
R1818:Card11 UTSW 5 140,871,315 (GRCm39) missense probably benign 0.00
R2027:Card11 UTSW 5 140,892,522 (GRCm39) missense probably damaging 0.96
R2436:Card11 UTSW 5 140,868,117 (GRCm39) missense possibly damaging 0.89
R2904:Card11 UTSW 5 140,874,888 (GRCm39) missense probably benign 0.09
R3706:Card11 UTSW 5 140,872,890 (GRCm39) missense probably damaging 0.99
R3708:Card11 UTSW 5 140,872,890 (GRCm39) missense probably damaging 0.99
R4778:Card11 UTSW 5 140,869,537 (GRCm39) splice site probably null
R4877:Card11 UTSW 5 140,871,632 (GRCm39) missense probably damaging 1.00
R4889:Card11 UTSW 5 140,871,700 (GRCm39) missense possibly damaging 0.75
R4910:Card11 UTSW 5 140,860,169 (GRCm39) missense probably damaging 1.00
R5011:Card11 UTSW 5 140,862,275 (GRCm39) missense possibly damaging 0.93
R5257:Card11 UTSW 5 140,862,180 (GRCm39) missense possibly damaging 0.93
R5258:Card11 UTSW 5 140,862,180 (GRCm39) missense possibly damaging 0.93
R5682:Card11 UTSW 5 140,888,666 (GRCm39) nonsense probably null
R5754:Card11 UTSW 5 140,885,524 (GRCm39) missense probably damaging 0.99
R5873:Card11 UTSW 5 140,894,393 (GRCm39) missense probably damaging 1.00
R6184:Card11 UTSW 5 140,884,033 (GRCm39) missense probably damaging 1.00
R6792:Card11 UTSW 5 140,899,064 (GRCm39) missense probably damaging 1.00
R6825:Card11 UTSW 5 140,863,837 (GRCm39) missense probably benign
R7008:Card11 UTSW 5 140,859,148 (GRCm39) missense probably damaging 1.00
R7291:Card11 UTSW 5 140,886,825 (GRCm39) missense probably damaging 1.00
R7376:Card11 UTSW 5 140,883,993 (GRCm39) missense probably benign 0.01
R7526:Card11 UTSW 5 140,899,184 (GRCm39) splice site probably null
R7683:Card11 UTSW 5 140,881,781 (GRCm39) missense probably benign
R7813:Card11 UTSW 5 140,885,419 (GRCm39) missense probably damaging 1.00
R7831:Card11 UTSW 5 140,859,167 (GRCm39) missense possibly damaging 0.61
R7911:Card11 UTSW 5 140,867,755 (GRCm39) critical splice donor site probably null
R8154:Card11 UTSW 5 140,886,732 (GRCm39) missense probably damaging 1.00
R8224:Card11 UTSW 5 140,888,632 (GRCm39) missense possibly damaging 0.70
R8272:Card11 UTSW 5 140,875,794 (GRCm39) missense probably damaging 1.00
R8714:Card11 UTSW 5 140,899,147 (GRCm39) missense possibly damaging 0.67
R8715:Card11 UTSW 5 140,871,315 (GRCm39) missense probably benign 0.00
R9065:Card11 UTSW 5 140,894,297 (GRCm39) missense probably damaging 1.00
R9211:Card11 UTSW 5 140,869,375 (GRCm39) missense probably benign 0.16
R9215:Card11 UTSW 5 140,866,154 (GRCm39) missense possibly damaging 0.64
R9269:Card11 UTSW 5 140,892,516 (GRCm39) missense probably damaging 0.99
R9385:Card11 UTSW 5 140,871,276 (GRCm39) missense probably benign 0.44
R9421:Card11 UTSW 5 140,869,462 (GRCm39) missense probably damaging 0.97
R9424:Card11 UTSW 5 140,894,395 (GRCm39) missense probably damaging 1.00
R9444:Card11 UTSW 5 140,894,393 (GRCm39) missense probably damaging 1.00
V7732:Card11 UTSW 5 140,862,250 (GRCm39) nonsense probably null
X0067:Card11 UTSW 5 140,871,347 (GRCm39) missense possibly damaging 0.60
Z1177:Card11 UTSW 5 140,883,996 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCTCTATGTCTCACCAGCAG -3'
(R):5'- GAGGACAGGGCGGTAGTTATTC -3'

Sequencing Primer
(F):5'- CTATGTCTCACCAGCAGGAGTTG -3'
(R):5'- ACAGGGCGGTAGTTATTCCTACTTC -3'
Posted On 2019-11-12