Incidental Mutation 'R1612:Fmo3'
ID176837
Institutional Source Beutler Lab
Gene Symbol Fmo3
Ensembl Gene ENSMUSG00000026691
Gene Nameflavin containing monooxygenase 3
Synonyms
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162953800-162984528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162967885 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 127 (V127A)
Ref Sequence ENSEMBL: ENSMUSP00000028010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028010]
Predicted Effect probably damaging
Transcript: ENSMUST00000028010
AA Change: V127A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028010
Gene: ENSMUSG00000026691
AA Change: V127A

DomainStartEndE-ValueType
Pfam:FMO-like 2 534 7.7e-286 PFAM
Pfam:Pyr_redox_2 3 245 4.4e-15 PFAM
Pfam:Pyr_redox_3 6 220 1.1e-11 PFAM
Pfam:NAD_binding_8 7 71 3.1e-7 PFAM
Pfam:K_oxygenase 79 224 6.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142759
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Adh7 T C 3: 138,228,881 I355T possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Frem3 A G 8: 80,614,861 D1261G probably damaging Het
Gabbr1 A G 17: 37,070,669 Y775C probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Lvrn G T 18: 46,894,703 A862S probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Med16 A G 10: 79,899,245 S461P probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Nav2 T A 7: 49,571,211 N1715K probably damaging Het
Ndc1 A G 4: 107,395,068 probably benign Het
Ngly1 G T 14: 16,290,867 G450* probably null Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Serpinh1 T C 7: 99,348,931 D164G probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Tsen34 G T 7: 3,695,396 G180W probably damaging Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Fmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fmo3 APN 1 162964030 missense probably benign 0.15
IGL01124:Fmo3 APN 1 162958261 missense probably damaging 1.00
IGL01645:Fmo3 APN 1 162964006 missense possibly damaging 0.53
IGL01710:Fmo3 APN 1 162983043 missense probably damaging 1.00
IGL01943:Fmo3 APN 1 162967006 missense probably benign 0.01
IGL02489:Fmo3 APN 1 162954287 missense possibly damaging 0.75
IGL02503:Fmo3 APN 1 162968864 missense probably benign 0.03
IGL02743:Fmo3 APN 1 162958483 missense probably damaging 1.00
IGL02974:Fmo3 APN 1 162983050 missense probably damaging 1.00
IGL03023:Fmo3 APN 1 162958465 missense probably benign 0.00
R0554:Fmo3 UTSW 1 162954332 missense probably benign 0.03
R0629:Fmo3 UTSW 1 162958227 splice site probably benign
R1209:Fmo3 UTSW 1 162964028 missense probably benign 0.00
R1213:Fmo3 UTSW 1 162967823 missense probably damaging 1.00
R1636:Fmo3 UTSW 1 162954425 missense probably benign
R1710:Fmo3 UTSW 1 162967787 missense possibly damaging 0.59
R1764:Fmo3 UTSW 1 162958573 missense possibly damaging 0.79
R1775:Fmo3 UTSW 1 162968725 missense possibly damaging 0.54
R1906:Fmo3 UTSW 1 162966906 missense probably damaging 1.00
R2363:Fmo3 UTSW 1 162954315 missense probably damaging 0.98
R2418:Fmo3 UTSW 1 162966958 missense probably benign
R2519:Fmo3 UTSW 1 162958305 missense probably damaging 1.00
R3940:Fmo3 UTSW 1 162963986 missense probably benign 0.01
R3977:Fmo3 UTSW 1 162958578 missense probably damaging 0.99
R4779:Fmo3 UTSW 1 162968838 missense probably damaging 1.00
R4846:Fmo3 UTSW 1 162954311 missense possibly damaging 0.94
R4892:Fmo3 UTSW 1 162968731 missense probably benign 0.00
R5102:Fmo3 UTSW 1 162963977 missense probably benign 0.01
R5516:Fmo3 UTSW 1 162954426 nonsense probably null
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R7050:Fmo3 UTSW 1 162963904 missense probably damaging 0.98
R7088:Fmo3 UTSW 1 162968865 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTGAAATAGACACCACGAGCCTGTTA -3'
(R):5'- AGCCATGCTTTTGTGAGACCATAAACT -3'

Sequencing Primer
(F):5'- AATTCTTGACAGATGTGTAGGTGG -3'
(R):5'- GCTTTTGTGAGACCATAAACTTAACC -3'
Posted On2014-04-24