Incidental Mutation 'R0699:Aimp1'
ID218737
Institutional Source Beutler Lab
Gene Symbol Aimp1
Ensembl Gene ENSMUSG00000028029
Gene Nameaminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Synonyms9830137A06Rik, AIMP1/p43, Scye1, Emap2, EMAPII
MMRRC Submission 038883-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R0699 (G1)
Quality Score57
Status Validated
Chromosome3
Chromosomal Location132660499-132684370 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 132674865 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029663] [ENSMUST00000196206] [ENSMUST00000196963] [ENSMUST00000197793] [ENSMUST00000198513]
Predicted Effect probably benign
Transcript: ENSMUST00000029663
SMART Domains Protein: ENSMUSP00000029663
Gene: ENSMUSG00000028029

DomainStartEndE-ValueType
coiled coil region 17 84 N/A INTRINSIC
low complexity region 124 144 N/A INTRINSIC
Pfam:tRNA_bind 164 257 2.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196206
SMART Domains Protein: ENSMUSP00000142914
Gene: ENSMUSG00000028029

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197646
Predicted Effect probably benign
Transcript: ENSMUST00000197793
SMART Domains Protein: ENSMUSP00000142534
Gene: ENSMUSG00000028029

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198513
SMART Domains Protein: ENSMUSP00000142513
Gene: ENSMUSG00000028029

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200025
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display delayed wound healing and decreased inflammatory response after wounding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik G T 4: 144,419,752 N110K probably damaging Het
2010300C02Rik T C 1: 37,612,330 D1152G possibly damaging Het
Abca13 G A 11: 9,588,508 probably benign Het
Abcb6 C T 1: 75,171,909 E89K probably damaging Het
Adam25 C A 8: 40,755,974 T759K probably benign Het
Adgrf5 G A 17: 43,422,661 probably null Het
Aldh3a2 C T 11: 61,262,322 V193I probably benign Het
Ank2 C T 3: 126,929,829 V950I probably benign Het
Aspn A G 13: 49,551,782 D40G possibly damaging Het
C1rl A G 6: 124,508,636 D322G probably benign Het
Car5a T C 8: 121,944,816 probably benign Het
Cfap157 T A 2: 32,779,010 K360N probably damaging Het
Cilp T A 9: 65,270,326 F117Y probably damaging Het
Cntnap5c T G 17: 58,042,498 W269G probably damaging Het
Col6a1 A G 10: 76,716,280 V459A unknown Het
Commd3 A G 2: 18,674,975 E165G possibly damaging Het
Cops3 A C 11: 59,826,322 Y244D probably damaging Het
Cpne5 T A 17: 29,209,693 K108N probably damaging Het
Ddx41 A G 13: 55,531,299 probably benign Het
Dnhd1 T C 7: 105,651,906 Y157H probably damaging Het
Dpp8 A T 9: 65,054,894 L405F probably benign Het
Dync2h1 G T 9: 7,103,680 A365E probably benign Het
Dysf C T 6: 84,190,846 R1757W probably benign Het
Eif1ad T A 19: 5,368,698 V93D possibly damaging Het
Eif2ak3 T C 6: 70,892,530 F734L probably benign Het
F8 T C X: 75,379,624 probably benign Het
Fbxl14 T C 6: 119,480,754 Y299H probably benign Het
Fmo1 T C 1: 162,833,772 N314S probably benign Het
Fnip2 T C 3: 79,481,139 T762A probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Gm9932 T C 5: 100,199,072 V43A probably damaging Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Hmcn1 T C 1: 150,819,410 T248A probably damaging Het
Hook1 T A 4: 95,995,840 probably benign Het
Ifne T C 4: 88,879,777 S135G probably benign Het
Igkv13-84 G A 6: 68,939,651 probably benign Het
Itm2b T A 14: 73,364,625 N211I probably damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a A T 13: 46,799,213 W699R possibly damaging Het
Kmt2e T C 5: 23,473,583 V220A probably benign Het
Macrod2 T C 2: 140,418,916 probably null Het
Map3k6 A G 4: 133,248,126 E724G probably damaging Het
Mgam T C 6: 40,643,019 L14P possibly damaging Het
Morc1 T A 16: 48,592,614 M706K probably benign Het
Muc2 T C 7: 141,752,300 V242A probably damaging Het
Mx2 T A 16: 97,544,553 V57E probably damaging Het
Myh14 C A 7: 44,624,971 A1339S possibly damaging Het
Myom1 G T 17: 71,067,313 S595I probably damaging Het
Nav1 T A 1: 135,452,949 M1471L probably benign Het
Ncapd2 A C 6: 125,169,880 S1248A probably benign Het
Ncbp1 T C 4: 46,147,528 V125A probably benign Het
Ncor2 A T 5: 125,029,112 probably benign Het
Nobox T A 6: 43,307,210 Q134L probably benign Het
Npc1 T C 18: 12,210,575 T454A probably benign Het
Ntng1 G T 3: 109,872,295 T322K probably damaging Het
Olfm5 T C 7: 104,154,119 E379G probably damaging Het
Olfr1202 A T 2: 88,817,224 N18Y probably damaging Het
Olfr1212 C T 2: 88,958,616 T50I probably benign Het
Olfr1218 C T 2: 89,055,292 V45M possibly damaging Het
Olfr1378 T C 11: 50,969,818 S267P probably damaging Het
Olfr362 T C 2: 37,105,062 D196G possibly damaging Het
Oma1 T C 4: 103,353,595 S433P probably damaging Het
Parp14 G A 16: 35,860,585 T226M probably damaging Het
Parp8 A T 13: 116,922,584 H168Q probably benign Het
Pik3cg G A 12: 32,197,342 probably benign Het
Pla2g16 T A 19: 7,558,001 probably null Het
Pla2g3 T C 11: 3,492,000 F388S probably damaging Het
Pllp T C 8: 94,696,032 probably null Het
Ppfibp1 T A 6: 147,026,222 V778E probably damaging Het
Prkci T C 3: 31,050,273 V595A possibly damaging Het
Prune2 T A 19: 17,123,955 D2274E probably damaging Het
Rad51ap2 A T 12: 11,457,600 T508S probably benign Het
Ranbp3l T C 15: 9,058,769 probably null Het
Rfc1 A C 5: 65,319,399 probably null Het
Rin3 G A 12: 102,369,575 V502I probably damaging Het
Rtn4rl1 A T 11: 75,265,222 H160L possibly damaging Het
Rtn4rl1 A T 11: 75,265,224 I161F probably benign Het
Serpinb9b A T 13: 33,033,566 M116L probably benign Het
Sgo2a C T 1: 57,998,149 R18* probably null Het
Sh3gl2 T A 4: 85,347,171 D31E probably benign Het
Slc38a9 T C 13: 112,723,289 L419S probably damaging Het
Sp8 AGCGGCGGCGGCGGCGG AGCGGCGGCGGCGG 12: 118,848,820 probably benign Het
Spen G T 4: 141,474,391 N2308K possibly damaging Het
Stac2 A G 11: 98,042,785 I156T possibly damaging Het
Stambp A G 6: 83,556,321 F320S probably damaging Het
Tas2r117 A T 6: 132,803,198 N100Y probably damaging Het
Tigd3 A T 19: 5,891,946 S385R probably benign Het
Tmem30c T C 16: 57,276,789 D136G possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnrc6c A G 11: 117,722,621 Q535R probably benign Het
Trmt2a T C 16: 18,249,529 V22A probably benign Het
Wipf3 A C 6: 54,483,832 K88N probably damaging Het
Zcchc6 G A 13: 59,782,014 probably benign Het
Zfp974 T C 7: 27,911,991 E103G possibly damaging Het
Zscan10 C T 17: 23,608,118 T135I probably damaging Het
Other mutations in Aimp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Aimp1 APN 3 132677143 splice site probably benign
IGL00742:Aimp1 APN 3 132671981 nonsense probably null
IGL01863:Aimp1 APN 3 132672092 missense probably benign 0.03
IGL02432:Aimp1 APN 3 132673977 missense probably benign
R0305:Aimp1 UTSW 3 132673986 missense possibly damaging 0.89
R1734:Aimp1 UTSW 3 132674796 missense probably damaging 1.00
R1793:Aimp1 UTSW 3 132674064 missense probably benign 0.21
R1975:Aimp1 UTSW 3 132677099 missense possibly damaging 0.81
R2010:Aimp1 UTSW 3 132667492 missense probably benign 0.01
R4424:Aimp1 UTSW 3 132667492 missense probably benign 0.01
R4583:Aimp1 UTSW 3 132677047 missense probably damaging 0.99
R6135:Aimp1 UTSW 3 132672083 missense probably benign 0.30
R6285:Aimp1 UTSW 3 132667504 missense possibly damaging 0.81
X0057:Aimp1 UTSW 3 132677112 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCACCTCACATGGACCGC -3'
(R):5'- GTGAGAGTCCTATACCCAATGTCCCAA -3'

Sequencing Primer
(F):5'- TGGCTTGGGTAACAAAAGTCC -3'
(R):5'- TATACCCAATGTCCCAATGACTAC -3'
Posted On2014-08-20