Incidental Mutation 'R2130:Adgrl2'
ID227928
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Nameadhesion G protein-coupled receptor L2
SynonymsLec1, Lphn2, Lphh1
MMRRC Submission 040133-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2130 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location148815583-148990555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148890488 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 71 (I71V)
Ref Sequence ENSEMBL: ENSMUSP00000142865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098518
SMART Domains Protein: ENSMUSP00000096118
Gene: ENSMUSG00000028184

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 96 4.2e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106128
AA Change: I71V

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195988
AA Change: I71V

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196526
AA Change: I71V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197567
AA Change: I71V

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198779
AA Change: I71V

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199059
AA Change: I71V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199238
AA Change: I71V

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199750
AA Change: I71V

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200154
AA Change: I71V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200543
AA Change: I71V

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: I71V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Adgrv1 T C 13: 81,581,727 T212A possibly damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apaf1 A T 10: 91,060,165 Y348* probably null Het
Apobr A G 7: 126,587,206 T630A probably benign Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asic1 A T 15: 99,671,875 T26S possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atrnl1 G A 19: 57,654,994 G438D probably damaging Het
Bbc3 T C 7: 16,312,343 V68A possibly damaging Het
Birc6 T C 17: 74,659,154 probably benign Het
Btnl9 A G 11: 49,180,696 F100S probably damaging Het
Ccpg1 A G 9: 73,013,158 N685S probably damaging Het
Ces3b T A 8: 105,092,975 probably null Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clhc1 A G 11: 29,557,663 I126V probably benign Het
Crocc T C 4: 141,029,102 I1071V probably benign Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Dnajc8 T C 4: 132,544,059 S62P possibly damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Dram2 T A 3: 106,570,760 M136K possibly damaging Het
Dtx2 T A 5: 136,012,040 F100I probably damaging Het
Dync2h1 A T 9: 7,011,253 W3654R probably damaging Het
Fam129b A G 2: 32,923,647 K624R probably benign Het
Fam208a T A 14: 27,446,388 Y296N probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm6578 C A 6: 12,100,187 noncoding transcript Het
Gm8298 T C 3: 59,865,348 V91A probably damaging Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Gm9797 G T 10: 11,609,369 noncoding transcript Het
Golga3 T C 5: 110,202,939 probably null Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Isoc2b A T 7: 4,851,439 I31N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lamc2 T A 1: 153,127,124 D1037V probably damaging Het
Lhfpl2 A G 13: 94,192,049 D206G possibly damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Mgat2 T C 12: 69,185,294 F214S probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Myh10 A G 11: 68,807,289 probably benign Het
Myo15b G A 11: 115,871,643 V1229I probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr683 T A 7: 105,143,550 I254F probably benign Het
Optc A T 1: 133,903,796 probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psph T A 5: 129,787,539 probably null Het
Ptpro A G 6: 137,411,116 probably null Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,448,417 probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf17 T C 14: 56,493,354 V1205A probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sgo2b T C 8: 63,927,147 R884G probably benign Het
Slc10a5 G T 3: 10,335,218 D127E probably benign Het
Slc25a35 T G 11: 68,968,965 S101R possibly damaging Het
Slc6a13 T C 6: 121,325,041 L194P possibly damaging Het
Snw1 T G 12: 87,452,703 probably benign Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Srsf12 C T 4: 33,225,764 probably benign Het
Ssxa1 T A X: 21,119,342 probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tkfc A G 19: 10,596,041 I279T probably damaging Het
Tmem98 A G 11: 80,817,522 E106G probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn T C 2: 76,742,517 T24265A possibly damaging Het
Usp37 A G 1: 74,461,656 V582A probably damaging Het
Vps13b T A 15: 35,671,400 I1683N probably benign Het
Vps13d C T 4: 145,156,101 R968H probably benign Het
Vwf C T 6: 125,657,057 T166I probably damaging Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp459 A T 13: 67,408,276 H229Q probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zmynd19 T A 2: 24,952,636 Y15* probably null Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148865608 missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148826498 missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148836527 missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148858975 missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148828489 nonsense probably null
IGL02468:Adgrl2 APN 3 148890480 missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148826525 missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148890605 missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148817400 missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148859380 missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148859063 missense probably damaging 1.00
R0165:Adgrl2 UTSW 3 148852863 splice site probably benign
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0344:Adgrl2 UTSW 3 148865595 splice site probably null
R0488:Adgrl2 UTSW 3 148846905 missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148859218 missense probably damaging 1.00
R0630:Adgrl2 UTSW 3 148839244 missense probably damaging 0.98
R0674:Adgrl2 UTSW 3 148837679 missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148822981 missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148859273 missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148852762 missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148865608 missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148852593 missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148817244 missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148826475 missense probably damaging 1.00
R2131:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148851934 missense probably damaging 1.00
R2997:Adgrl2 UTSW 3 148817649 missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148817551 missense probably damaging 1.00
R3416:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148858963 missense probably damaging 1.00
R3760:Adgrl2 UTSW 3 148817235 missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148839152 missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148859020 missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148890463 missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148823036 missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148823713 missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148817844 missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148837562 critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148859164 missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148859175 missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148823009 missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148858942 missense probably damaging 1.00
R6284:Adgrl2 UTSW 3 148826507 missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148817286 missense probably damaging 1.00
X0009:Adgrl2 UTSW 3 148852654 missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148865594 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTAGACAAAAGCTTCGCTGAGGG -3'
(R):5'- GATGCCTTGCTGAAACAATCTG -3'

Sequencing Primer
(F):5'- TGTGCACAtgcatctacc -3'
(R):5'- CATATGAGAGTGGAAGCTTGACATTC -3'
Posted On2014-09-17