Incidental Mutation 'R3437:Slfn2'
ID267248
Institutional Source Beutler Lab
Gene Symbol Slfn2
Ensembl Gene ENSMUSG00000072620
Gene Nameschlafen 2
SynonymsShlf2
MMRRC Submission 040655-MU
Accession Numbers

MGI: 1313258

Is this an essential gene? Probably non essential (E-score: 0.035) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83065112-83070678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83069564 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 123 (H123L)
Ref Sequence ENSEMBL: ENSMUSP00000035562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038038]
Predicted Effect probably benign
Transcript: ENSMUST00000038038
AA Change: H123L

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000035562
Gene: ENSMUSG00000072620
AA Change: H123L

DomainStartEndE-ValueType
low complexity region 162 172 N/A INTRINSIC
Pfam:AlbA_2 231 365 4.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214134
Meta Mutation Damage Score 0.1444 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit increased susceptibility to bacterial and viral infections, reduced T cell numbers, decreased T cell proliferation, and increased apoptosis of activated T cells. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Chemically induced(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Slfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Slfn2 APN 11 83069844 missense probably benign 0.32
IGL02407:Slfn2 APN 11 83069576 missense probably benign 0.00
IGL03303:Slfn2 APN 11 83069467 missense possibly damaging 0.82
elektra UTSW 11 83069600 missense probably damaging 0.99
elektra2 UTSW 11 83069564 missense probably benign 0.05
R2270:Slfn2 UTSW 11 83069935 missense probably damaging 0.99
R2392:Slfn2 UTSW 11 83065328 missense possibly damaging 0.91
R3436:Slfn2 UTSW 11 83069564 missense probably benign 0.05
R5849:Slfn2 UTSW 11 83069576 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTCACCTCAGAAAACAGGAG -3'
(R):5'- TTCCACTTCAGGGAAGGCTATG -3'

Sequencing Primer
(F):5'- GGAGAATGCAAACATCTCTCTAGCTG -3'
(R):5'- AACTCTGGTCTGACACAGGG -3'
Posted On2015-02-18