Incidental Mutation 'R3437:Polq'
ID267257
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Namepolymerase (DNA directed), theta
SynonymsA430110D14Rik
MMRRC Submission 040655-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #R3437 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37011786-37095417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37062337 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1342 (N1342I)
Ref Sequence ENSEMBL: ENSMUSP00000071396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
Predicted Effect probably damaging
Transcript: ENSMUST00000054034
AA Change: N1621I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: N1621I

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071452
AA Change: N1342I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: N1342I

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182622
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,639,294 probably null Het
Ambp T C 4: 63,149,484 E163G probably benign Het
Amy1 G A 3: 113,556,009 A504V probably damaging Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Avl9 T C 6: 56,736,627 V290A probably benign Het
Bad A G 19: 6,942,431 R37G probably benign Het
Bicra T C 7: 15,989,298 D98G possibly damaging Het
Col4a4 G A 1: 82,497,168 T650M unknown Het
Cyp11b2 T C 15: 74,855,449 R128G probably benign Het
Dst T C 1: 34,190,222 S1974P probably damaging Het
Fabp1 T C 6: 71,201,611 L24P probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Gmnc G T 16: 26,960,467 H221Q probably benign Het
Homer1 T C 13: 93,366,421 probably benign Het
Kit A G 5: 75,645,905 D690G probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mc3r C T 2: 172,249,668 T270I probably benign Het
Mrgpra3 A C 7: 47,589,566 L204W probably damaging Het
Mroh1 C T 15: 76,433,608 T839I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr312 A T 11: 58,831,324 M57L probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
P4ha3 C T 7: 100,285,624 A31V possibly damaging Het
Plch2 A G 4: 154,991,013 probably null Het
Plpp2 A T 10: 79,527,813 probably null Het
Pter T A 2: 13,000,994 L326H probably benign Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slc8a2 T G 7: 16,158,885 V824G probably damaging Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Tro G A X: 150,646,256 probably benign Het
Uspl1 T A 5: 149,214,697 probably benign Het
Uty A G Y: 1,158,336 I522T probably benign Het
Vmn1r120 A C 7: 21,053,657 L43W probably damaging Het
Vmn2r16 A T 5: 109,330,496 D39V probably damaging Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wnt16 T C 6: 22,298,134 V333A probably damaging Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfy1 A T Y: 726,357 D469E possibly damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 37065247 splice site probably benign
IGL00539:Polq APN 16 37060569 missense probably damaging 0.98
IGL00960:Polq APN 16 37060512 missense probably damaging 0.96
IGL01100:Polq APN 16 37061112 missense probably benign
IGL01112:Polq APN 16 37017309 missense probably damaging 1.00
IGL01138:Polq APN 16 37045869 missense possibly damaging 0.94
IGL01432:Polq APN 16 37071822 splice site probably benign
IGL01522:Polq APN 16 37027903 missense probably damaging 1.00
IGL01565:Polq APN 16 37013113 missense probably benign 0.00
IGL01592:Polq APN 16 37034850 missense probably benign 0.01
IGL01690:Polq APN 16 37062838 missense probably damaging 0.97
IGL01943:Polq APN 16 37061443 missense possibly damaging 0.47
IGL02531:Polq APN 16 37062374 missense possibly damaging 0.75
IGL02553:Polq APN 16 37041768 missense probably damaging 1.00
IGL02623:Polq APN 16 37060375 missense probably benign 0.04
IGL02692:Polq APN 16 37060627 missense probably damaging 1.00
IGL02717:Polq APN 16 37022740 missense probably damaging 1.00
IGL02937:Polq APN 16 37013109 missense probably benign 0.14
IGL02959:Polq APN 16 37086566 missense probably damaging 1.00
IGL03086:Polq APN 16 37091049 missense probably benign 0.02
IGL03141:Polq APN 16 37017358 splice site probably benign
IGL03302:Polq APN 16 37071772 missense probably damaging 1.00
IGL03393:Polq APN 16 37044794 missense probably damaging 1.00
R0013:Polq UTSW 16 37061839 missense possibly damaging 0.56
R0082:Polq UTSW 16 37017257 missense probably benign 0.01
R0212:Polq UTSW 16 37066854 missense probably damaging 0.99
R0387:Polq UTSW 16 37029430 missense probably damaging 1.00
R0387:Polq UTSW 16 37089317 missense probably damaging 1.00
R0427:Polq UTSW 16 37061993 nonsense probably null
R0454:Polq UTSW 16 37034890 missense probably damaging 0.98
R0513:Polq UTSW 16 37094502 missense probably damaging 1.00
R0622:Polq UTSW 16 37060993 missense probably benign 0.02
R0848:Polq UTSW 16 37062130 missense probably benign 0.08
R1142:Polq UTSW 16 37013217 missense probably damaging 0.98
R1218:Polq UTSW 16 37029446 missense possibly damaging 0.93
R1331:Polq UTSW 16 37041747 missense probably damaging 1.00
R1398:Polq UTSW 16 37062495 missense possibly damaging 0.87
R1424:Polq UTSW 16 37086528 missense probably damaging 1.00
R1644:Polq UTSW 16 37060264 missense probably damaging 0.96
R1777:Polq UTSW 16 37060224 missense possibly damaging 0.94
R1820:Polq UTSW 16 37029418 missense possibly damaging 0.48
R1854:Polq UTSW 16 37062109 missense probably benign 0.01
R1880:Polq UTSW 16 37086592 missense possibly damaging 0.90
R1932:Polq UTSW 16 37062304 missense possibly damaging 0.92
R2008:Polq UTSW 16 37062482 missense probably damaging 0.96
R2014:Polq UTSW 16 37078366 missense probably damaging 1.00
R2026:Polq UTSW 16 37062745 missense possibly damaging 0.93
R2178:Polq UTSW 16 37062829 missense probably damaging 1.00
R2259:Polq UTSW 16 37062097 missense probably benign 0.03
R2266:Polq UTSW 16 37062153 missense possibly damaging 0.59
R2305:Polq UTSW 16 37062337 missense probably damaging 0.99
R2370:Polq UTSW 16 37073939 missense probably damaging 1.00
R2504:Polq UTSW 16 37011942 missense unknown
R2517:Polq UTSW 16 37089325 missense probably damaging 1.00
R2697:Polq UTSW 16 37042153 missense probably damaging 1.00
R2858:Polq UTSW 16 37062753 missense possibly damaging 0.88
R3436:Polq UTSW 16 37062337 missense probably damaging 0.99
R3699:Polq UTSW 16 37042156 missense probably damaging 1.00
R3838:Polq UTSW 16 37078349 missense probably damaging 1.00
R3875:Polq UTSW 16 37074027 missense probably damaging 0.99
R4050:Polq UTSW 16 37092820 critical splice acceptor site probably null
R4172:Polq UTSW 16 37060758 missense probably benign 0.02
R4238:Polq UTSW 16 37013181 missense probably damaging 1.00
R4240:Polq UTSW 16 37013181 missense probably damaging 1.00
R4280:Polq UTSW 16 37082057 missense probably damaging 1.00
R4296:Polq UTSW 16 37061301 missense possibly damaging 0.94
R4360:Polq UTSW 16 37060339 missense probably benign 0.00
R4373:Polq UTSW 16 37013181 missense probably damaging 1.00
R4375:Polq UTSW 16 37013181 missense probably damaging 1.00
R4376:Polq UTSW 16 37013181 missense probably damaging 1.00
R4509:Polq UTSW 16 37048563 missense probably damaging 1.00
R4510:Polq UTSW 16 37048563 missense probably damaging 1.00
R4511:Polq UTSW 16 37048563 missense probably damaging 1.00
R4543:Polq UTSW 16 37060785 missense probably benign 0.43
R4633:Polq UTSW 16 37048542 missense probably damaging 1.00
R4739:Polq UTSW 16 37041747 missense probably damaging 1.00
R4834:Polq UTSW 16 37027814 missense probably damaging 1.00
R4841:Polq UTSW 16 37048783 critical splice donor site probably null
R4842:Polq UTSW 16 37048783 critical splice donor site probably null
R4937:Polq UTSW 16 37027912 missense probably benign 0.01
R4955:Polq UTSW 16 37061082 missense probably benign 0.32
R4992:Polq UTSW 16 37061162 missense possibly damaging 0.59
R5008:Polq UTSW 16 37062387 missense probably benign
R5221:Polq UTSW 16 37042178 missense probably damaging 0.98
R5254:Polq UTSW 16 37089319 missense probably damaging 1.00
R5292:Polq UTSW 16 37061383 missense probably damaging 1.00
R5375:Polq UTSW 16 37082784 missense probably damaging 1.00
R5480:Polq UTSW 16 37013290 splice site probably benign
R5552:Polq UTSW 16 37094510 missense possibly damaging 0.93
R5591:Polq UTSW 16 37011885 utr 5 prime probably benign
R5653:Polq UTSW 16 37040534 missense probably damaging 1.00
R5708:Polq UTSW 16 37061018 missense probably damaging 0.98
R5754:Polq UTSW 16 37017263 missense probably benign
R5757:Polq UTSW 16 37086681 missense probably benign 0.01
R5764:Polq UTSW 16 37017344 missense probably damaging 0.97
R6019:Polq UTSW 16 37061764 missense probably damaging 1.00
R6170:Polq UTSW 16 37045812 missense possibly damaging 0.82
R6177:Polq UTSW 16 37071709 missense probably damaging 0.98
R6307:Polq UTSW 16 37017356 critical splice donor site probably null
R6499:Polq UTSW 16 37060827 missense probably benign 0.03
R6520:Polq UTSW 16 37060377 missense possibly damaging 0.88
R6598:Polq UTSW 16 37061631 missense probably benign 0.39
R6694:Polq UTSW 16 37015173 missense probably null 0.99
R6788:Polq UTSW 16 37077148 missense probably damaging 1.00
X0060:Polq UTSW 16 37017237 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGTCCCCAAGGAAAACTGG -3'
(R):5'- ATGAGGCCATTGTCATCAGCTG -3'

Sequencing Primer
(F):5'- TCCCCAAGGAAAACTGGTCAGAG -3'
(R):5'- CAGCACTTTCTTTACGAGGCAAGG -3'
Posted On2015-02-18