Incidental Mutation 'R3618:Mcm10'
ID268498
Institutional Source Beutler Lab
Gene Symbol Mcm10
Ensembl Gene ENSMUSG00000026669
Gene Nameminichromosome maintenance 10 replication initiation factor
SynonymsC330019M07Rik, 2410041F14Rik
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3618 (G1)
Quality Score215
Status Not validated
Chromosome2
Chromosomal Location4989714-5012791 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 4997102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027980] [ENSMUST00000102985]
Predicted Effect probably null
Transcript: ENSMUST00000027980
SMART Domains Protein: ENSMUSP00000027980
Gene: ENSMUSG00000026669

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 2e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102985
SMART Domains Protein: ENSMUSP00000100050
Gene: ENSMUSG00000026669

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 3.7e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151533
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryonic cell proliferation and early embryonic letahlity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Mcm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Mcm10 APN 2 5008628 missense probably benign 0.00
IGL02028:Mcm10 APN 2 5008700 missense possibly damaging 0.95
IGL02672:Mcm10 APN 2 5001281 missense probably benign 0.00
IGL03352:Mcm10 APN 2 4994596 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0320:Mcm10 UTSW 2 5004086 missense probably benign
R0379:Mcm10 UTSW 2 5008623 missense probably benign 0.05
R0385:Mcm10 UTSW 2 5004154 missense possibly damaging 0.82
R0519:Mcm10 UTSW 2 5008545 missense probably benign
R1537:Mcm10 UTSW 2 4998780 missense possibly damaging 0.77
R1597:Mcm10 UTSW 2 4998752 missense probably damaging 1.00
R1727:Mcm10 UTSW 2 5006525 missense probably benign 0.10
R1758:Mcm10 UTSW 2 5004050 missense probably damaging 1.00
R1997:Mcm10 UTSW 2 4993760 missense probably damaging 1.00
R4005:Mcm10 UTSW 2 5001003 missense probably damaging 1.00
R4870:Mcm10 UTSW 2 5004159 missense probably damaging 1.00
R5302:Mcm10 UTSW 2 5007370 missense probably benign 0.12
R5488:Mcm10 UTSW 2 4992118 missense probably damaging 1.00
R6921:Mcm10 UTSW 2 5000935 missense probably benign 0.00
X0020:Mcm10 UTSW 2 5007148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCACAGAATGCAAAGCC -3'
(R):5'- TCAAGTGAAGTCCAGAGCCC -3'

Sequencing Primer
(F):5'- CAGAATGCAAAGCCAAGCAATG -3'
(R):5'- TGAAGTCCAGAGCCCAGCAG -3'
Posted On2015-02-19