Incidental Mutation 'R3744:Gnai3'
ID271117
Institutional Source Beutler Lab
Gene Symbol Gnai3
Ensembl Gene ENSMUSG00000000001
Gene Nameguanine nucleotide binding protein (G protein), alpha inhibiting 3
SynonymsGalphai3
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108107280-108146146 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 108109398 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000001]
PDB Structure
Crystal structure of p115RhoGEF RGS domain in complex with G alpha 13 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000000001
SMART Domains Protein: ENSMUSP00000000001
Gene: ENSMUSG00000000001

DomainStartEndE-ValueType
G_alpha 13 353 4.43e-218 SMART
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling pathways. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes an alpha subunit and belongs to the G-alpha family. Mutation in this gene, resulting in a gly40-to-arg substitution, is associated with auriculocondylar syndrome, and shown to affect downstream targets in the G protein-coupled endothelin receptor pathway. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal basal cardiac function and beta-adrenergic sensitivity. Mice homozygous for a different knock-out allele exhibit enhanced T cell migration toward CXCR3 agonists. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Gnai3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Gnai3 APN 3 108115757 splice site probably benign
IGL01672:Gnai3 APN 3 108109459 missense probably damaging 1.00
IGL02708:Gnai3 APN 3 108118344 missense probably benign
IGL03067:Gnai3 APN 3 108118293 splice site probably benign
R0388:Gnai3 UTSW 3 108115757 splice site probably benign
R0554:Gnai3 UTSW 3 108123612 missense probably benign 0.01
R1696:Gnai3 UTSW 3 108109459 missense probably damaging 1.00
R1835:Gnai3 UTSW 3 108118407 missense probably benign
R2057:Gnai3 UTSW 3 108112496 missense probably benign
R5268:Gnai3 UTSW 3 108123541 critical splice donor site probably null
R6644:Gnai3 UTSW 3 108123536 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCGCTAGCTAAGATTCTGCG -3'
(R):5'- ATACATACGAAGAGGCAGCTGC -3'

Sequencing Primer
(F):5'- CTAGCTAAGATTCTGCGTGTTGC -3'
(R):5'- AGGCAGCTGCTTACATTCAG -3'
Posted On2015-03-18