Incidental Mutation 'R3744:Pop5'
ID271119
Institutional Source Beutler Lab
Gene Symbol Pop5
Ensembl Gene ENSMUSG00000060152
Gene Nameprocessing of precursor 5, ribonuclease P/MRP family (S. cerevisiae)
Synonyms2700077E03Rik, 1500019J17Rik, Rnasep3
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115235836-115245351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115240508 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 117 (Y117H)
Ref Sequence ENSEMBL: ENSMUSP00000118408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000081497] [ENSMUST00000112096] [ENSMUST00000112097] [ENSMUST00000135455]
Predicted Effect probably benign
Transcript: ENSMUST00000040555
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081497
AA Change: Y117H

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080215
Gene: ENSMUSG00000060152
AA Change: Y117H

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 115 2.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112096
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112097
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128954
Predicted Effect possibly damaging
Transcript: ENSMUST00000135455
AA Change: Y117H

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118408
Gene: ENSMUSG00000060152
AA Change: Y117H

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 117 3.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139853
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154800
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tcte1 A G 17: 45,539,671 D291G probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Pop5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Pop5 APN 5 115240559 unclassified probably benign
R0127:Pop5 UTSW 5 115240171 missense probably damaging 1.00
R2045:Pop5 UTSW 5 115238212 missense possibly damaging 0.94
R4408:Pop5 UTSW 5 115240777 unclassified probably benign
R5458:Pop5 UTSW 5 115240437 unclassified probably benign
R5607:Pop5 UTSW 5 115240201 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTACACGTGGGAGGTACGG -3'
(R):5'- AAAGCTCTTCAACGGGCTCTC -3'

Sequencing Primer
(F):5'- ATGGTGGCTGTTGTTCAGAGC -3'
(R):5'- TCAACGGGCTCTCTGTCCAG -3'
Posted On2015-03-18