Incidental Mutation 'R0377:Cic'
ID 30803
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Name capicua transcriptional repressor
Synonyms 1200010B10Rik
MMRRC Submission 038583-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R0377 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 24967129-24993584 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 24985224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 1157 (H1157N)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000165239] [ENSMUST00000169266]
AlphaFold Q924A2
Predicted Effect possibly damaging
Transcript: ENSMUST00000005578
AA Change: H250N

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: H250N

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163320
AA Change: H250N

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: H250N

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164440
Predicted Effect possibly damaging
Transcript: ENSMUST00000165239
AA Change: H250N

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: H250N

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167379
Predicted Effect probably damaging
Transcript: ENSMUST00000169266
AA Change: H1157N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: H1157N

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169743
Meta Mutation Damage Score 0.2785 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,265,922 (GRCm39) V107F possibly damaging Het
Acad11 T A 9: 103,958,891 (GRCm39) probably benign Het
Ache G A 5: 137,289,190 (GRCm39) E299K possibly damaging Het
Adam5 T C 8: 25,237,557 (GRCm39) T618A probably benign Het
Amigo2 T A 15: 97,144,261 (GRCm39) T54S possibly damaging Het
Anapc1 A G 2: 128,483,260 (GRCm39) probably null Het
Btaf1 A G 19: 36,966,402 (GRCm39) K1057E probably benign Het
Cep55 T A 19: 38,060,337 (GRCm39) L396* probably null Het
Cntnap5a A T 1: 116,220,259 (GRCm39) T690S probably benign Het
D5Ertd579e A T 5: 36,761,911 (GRCm39) C1319S probably benign Het
Dnah6 A G 6: 73,098,975 (GRCm39) S2027P possibly damaging Het
Dnai4 A G 4: 102,905,456 (GRCm39) V775A probably damaging Het
Dntt G A 19: 41,036,066 (GRCm39) W369* probably null Het
Esp18 T A 17: 39,720,835 (GRCm39) W27R probably benign Het
Fam227b A T 2: 125,966,920 (GRCm39) probably benign Het
Fbxo31 G A 8: 122,285,841 (GRCm39) probably benign Het
Gm13547 G A 2: 29,651,803 (GRCm39) probably null Het
Gnl2 T A 4: 124,940,175 (GRCm39) probably benign Het
Gpx2 G A 12: 76,841,930 (GRCm39) Q74* probably null Het
Gucy2c A G 6: 136,727,915 (GRCm39) probably null Het
Hoxa5 A T 6: 52,179,626 (GRCm39) W250R probably damaging Het
Izumo4 G A 10: 80,538,674 (GRCm39) R42H probably damaging Het
Kcnj12 G A 11: 60,960,222 (GRCm39) M71I probably benign Het
Kmt2b A T 7: 30,273,618 (GRCm39) L2333Q probably damaging Het
Mak T C 13: 41,202,824 (GRCm39) E177G probably damaging Het
Map3k7 T A 4: 31,985,731 (GRCm39) I218N probably damaging Het
Mark3 T C 12: 111,595,463 (GRCm39) L393P probably damaging Het
Msh4 A G 3: 153,602,527 (GRCm39) S234P probably benign Het
Mug1 A G 6: 121,834,320 (GRCm39) D367G probably benign Het
Mypn A G 10: 62,963,401 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,159 (GRCm39) V784A probably benign Het
Nutf2 T A 8: 106,605,504 (GRCm39) V113D probably damaging Het
Odad2 G A 18: 7,127,415 (GRCm39) R933C probably benign Het
Opn3 T C 1: 175,491,260 (GRCm39) M258V probably damaging Het
Or8k33 A T 2: 86,383,927 (GRCm39) D180E probably damaging Het
Osbpl7 A G 11: 96,946,760 (GRCm39) D211G probably damaging Het
Pcnx1 C T 12: 82,021,353 (GRCm39) probably benign Het
Plekhd1 G A 12: 80,753,210 (GRCm39) probably benign Het
Pnpla6 A G 8: 3,591,501 (GRCm39) E1165G probably damaging Het
Prkab2 T A 3: 97,569,633 (GRCm39) D66E probably benign Het
Prpsap2 A G 11: 61,631,826 (GRCm39) I177T possibly damaging Het
Ptpn23 A T 9: 110,217,200 (GRCm39) S885R possibly damaging Het
Rab26 A T 17: 24,749,019 (GRCm39) probably benign Het
Rab5a G A 17: 53,807,490 (GRCm39) M175I probably benign Het
Rassf9 T A 10: 102,381,510 (GRCm39) D297E probably benign Het
Rimbp2 C T 5: 128,880,925 (GRCm39) R161Q probably damaging Het
Rtp1 A G 16: 23,250,034 (GRCm39) Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 (GRCm39) L263F probably benign Het
Sec14l1 T G 11: 117,039,966 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spaca1 T C 4: 34,044,267 (GRCm39) probably null Het
Stk36 C T 1: 74,651,889 (GRCm39) P394L probably benign Het
Stk4 T C 2: 163,938,720 (GRCm39) I196T probably damaging Het
Sult1b1 A T 5: 87,665,235 (GRCm39) M233K probably damaging Het
Tmem8b C T 4: 43,674,005 (GRCm39) T212M probably damaging Het
Tmprss11g A T 5: 86,638,610 (GRCm39) F293I probably damaging Het
Tnfsf11 T G 14: 78,537,352 (GRCm39) T104P probably benign Het
Trmt2a G A 16: 18,067,567 (GRCm39) R80Q possibly damaging Het
Trps1 C A 15: 50,695,174 (GRCm39) E324* probably null Het
U2surp C T 9: 95,366,496 (GRCm39) V470I probably benign Het
Wdr18 G A 10: 79,803,336 (GRCm39) R400H probably benign Het
Zfp119b T A 17: 56,245,671 (GRCm39) H505L probably damaging Het
Zfp619 T A 7: 39,186,221 (GRCm39) C750* probably null Het
Zfr T C 15: 12,160,677 (GRCm39) I750T probably benign Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 24,991,549 (GRCm39) missense probably damaging 1.00
IGL01668:Cic APN 7 24,990,629 (GRCm39) missense possibly damaging 0.47
IGL02229:Cic APN 7 24,990,375 (GRCm39) missense probably damaging 0.96
IGL02506:Cic APN 7 24,990,282 (GRCm39) missense probably benign
IGL02794:Cic APN 7 24,985,069 (GRCm39) missense probably damaging 1.00
IGL03065:Cic APN 7 24,985,246 (GRCm39) splice site probably benign
IGL03304:Cic APN 7 24,984,274 (GRCm39) missense probably damaging 1.00
Capuccino UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
Cassock UTSW 7 24,988,338 (GRCm39) nonsense probably null
Monkey UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R4850_Cic_466 UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
1mM(1):Cic UTSW 7 24,990,214 (GRCm39) splice site probably benign
IGL03046:Cic UTSW 7 24,990,500 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0027:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0027:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0038:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0038:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0063:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0063:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0064:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0064:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0118:Cic UTSW 7 24,985,459 (GRCm39) missense probably damaging 1.00
R0193:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0193:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0241:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0241:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0462:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0462:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0800:Cic UTSW 7 24,984,662 (GRCm39) missense probably benign
R1253:Cic UTSW 7 24,990,373 (GRCm39) missense probably damaging 1.00
R1458:Cic UTSW 7 24,979,162 (GRCm39) intron probably benign
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1519:Cic UTSW 7 24,993,235 (GRCm39) critical splice acceptor site probably null
R1586:Cic UTSW 7 24,985,386 (GRCm39) missense probably damaging 1.00
R1824:Cic UTSW 7 24,987,691 (GRCm39) missense probably damaging 1.00
R1908:Cic UTSW 7 24,986,265 (GRCm39) missense probably damaging 1.00
R2045:Cic UTSW 7 24,970,961 (GRCm39) missense possibly damaging 0.53
R2063:Cic UTSW 7 24,972,876 (GRCm39) missense probably damaging 0.98
R2161:Cic UTSW 7 24,987,559 (GRCm39) splice site probably null
R2495:Cic UTSW 7 24,991,201 (GRCm39) splice site probably benign
R2865:Cic UTSW 7 24,972,646 (GRCm39) missense probably damaging 0.96
R3692:Cic UTSW 7 24,988,338 (GRCm39) nonsense probably null
R3709:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3710:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3872:Cic UTSW 7 24,971,124 (GRCm39) missense possibly damaging 0.92
R3946:Cic UTSW 7 24,971,771 (GRCm39) missense possibly damaging 0.93
R4199:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4426:Cic UTSW 7 24,993,433 (GRCm39) utr 3 prime probably benign
R4502:Cic UTSW 7 24,987,892 (GRCm39) missense probably damaging 1.00
R4585:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4586:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4614:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4664:Cic UTSW 7 24,990,099 (GRCm39) small deletion probably benign
R4688:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4695:Cic UTSW 7 24,973,013 (GRCm39) missense possibly damaging 0.72
R4696:Cic UTSW 7 24,987,908 (GRCm39) missense probably benign
R4746:Cic UTSW 7 24,987,905 (GRCm39) missense probably damaging 1.00
R4758:Cic UTSW 7 24,991,636 (GRCm39) missense possibly damaging 0.62
R4767:Cic UTSW 7 24,971,025 (GRCm39) missense possibly damaging 0.92
R4776:Cic UTSW 7 24,982,308 (GRCm39) missense possibly damaging 0.95
R4820:Cic UTSW 7 24,971,157 (GRCm39) missense possibly damaging 0.92
R4850:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4851:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4922:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R4989:Cic UTSW 7 24,986,535 (GRCm39) missense probably damaging 1.00
R5131:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R5718:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R5801:Cic UTSW 7 24,970,863 (GRCm39) missense possibly damaging 0.93
R5949:Cic UTSW 7 24,971,730 (GRCm39) missense probably damaging 1.00
R6000:Cic UTSW 7 24,971,423 (GRCm39) missense probably benign 0.33
R6246:Cic UTSW 7 24,971,067 (GRCm39) missense probably damaging 1.00
R6283:Cic UTSW 7 24,985,459 (GRCm39) missense probably damaging 1.00
R6364:Cic UTSW 7 24,972,248 (GRCm39) missense possibly damaging 0.72
R6481:Cic UTSW 7 24,987,706 (GRCm39) missense possibly damaging 0.56
R6919:Cic UTSW 7 24,971,202 (GRCm39) missense probably benign 0.04
R6920:Cic UTSW 7 24,990,107 (GRCm39) missense probably damaging 1.00
R6995:Cic UTSW 7 24,970,736 (GRCm39) missense possibly damaging 0.53
R7002:Cic UTSW 7 24,971,621 (GRCm39) missense probably damaging 0.99
R7113:Cic UTSW 7 24,972,869 (GRCm39) missense probably benign 0.08
R7560:Cic UTSW 7 24,972,278 (GRCm39) missense probably damaging 0.98
R7680:Cic UTSW 7 24,991,856 (GRCm39) missense probably damaging 0.96
R7698:Cic UTSW 7 24,972,597 (GRCm39) missense possibly damaging 0.72
R7746:Cic UTSW 7 24,988,207 (GRCm39) missense probably damaging 1.00
R7841:Cic UTSW 7 24,985,192 (GRCm39) missense probably damaging 1.00
R7879:Cic UTSW 7 24,984,551 (GRCm39) missense probably benign 0.10
R7916:Cic UTSW 7 24,987,715 (GRCm39) missense probably damaging 0.99
R7920:Cic UTSW 7 24,971,384 (GRCm39) missense probably benign
R8056:Cic UTSW 7 24,990,366 (GRCm39) missense possibly damaging 0.90
R8226:Cic UTSW 7 24,987,213 (GRCm39) missense probably damaging 1.00
R8281:Cic UTSW 7 24,971,249 (GRCm39) missense probably benign
R8847:Cic UTSW 7 24,970,631 (GRCm39) missense probably damaging 0.98
R8991:Cic UTSW 7 24,988,885 (GRCm39) missense probably damaging 1.00
R9083:Cic UTSW 7 24,985,470 (GRCm39) missense probably damaging 0.99
R9140:Cic UTSW 7 24,985,165 (GRCm39) missense probably damaging 0.99
R9200:Cic UTSW 7 24,971,940 (GRCm39) missense probably damaging 0.99
R9208:Cic UTSW 7 24,987,502 (GRCm39) missense probably benign 0.07
R9301:Cic UTSW 7 24,991,117 (GRCm39) missense probably damaging 1.00
R9408:Cic UTSW 7 24,971,414 (GRCm39) missense possibly damaging 0.70
R9569:Cic UTSW 7 24,972,120 (GRCm39) missense possibly damaging 0.85
R9752:Cic UTSW 7 24,971,403 (GRCm39) missense probably damaging 0.96
V7732:Cic UTSW 7 24,991,670 (GRCm39) missense probably benign
Z1176:Cic UTSW 7 24,970,444 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCCCAAGGAACGAGACTCATCTTC -3'
(R):5'- TGTGGACGAGTCCTCAAAAGCAAC -3'

Sequencing Primer
(F):5'- CTCATCTTCTGAAAAGGATGGACG -3'
(R):5'- AGCAGCAGTTCCCGTCTC -3'
Posted On 2013-04-24