Incidental Mutation 'R1458:Cic'
ID247290
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission 039513-MU
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R1458 (G1)
Quality Score34
Status Validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 25279737 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000165239] [ENSMUST00000169266]
Predicted Effect probably benign
Transcript: ENSMUST00000005578
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163320
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164440
Predicted Effect probably benign
Transcript: ENSMUST00000165239
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168956
Predicted Effect probably benign
Transcript: ENSMUST00000169266
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169743
Meta Mutation Damage Score 0.0968 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik A G 9: 60,769,761 noncoding transcript Het
A430110L20Rik T A 1: 181,227,858 noncoding transcript Het
Abce1 T C 8: 79,707,235 K63R possibly damaging Het
Acp6 A G 3: 97,173,788 probably benign Het
Adamts13 T A 2: 26,988,354 L579Q probably damaging Het
Adamtsl3 T A 7: 82,523,320 M497K probably damaging Het
Adgrb2 T A 4: 130,014,591 M1042K possibly damaging Het
Akap12 A T 10: 4,353,693 S168C probably damaging Het
Akap3 A T 6: 126,865,554 M379L probably damaging Het
Aldh6a1 C T 12: 84,439,663 M135I probably null Het
Arhgef12 A G 9: 42,988,998 S860P probably damaging Het
Atp11b A C 3: 35,789,558 T185P probably damaging Het
Bcas1 T C 2: 170,387,951 D243G probably damaging Het
Cdhr2 T A 13: 54,717,872 S228T probably damaging Het
Cmya5 T A 13: 93,065,327 I3376L probably benign Het
Ctrc C A 4: 141,846,224 probably null Het
D230025D16Rik T C 8: 105,246,556 probably null Het
Dchs1 G T 7: 105,755,244 P2697Q probably damaging Het
Dmbt1 A G 7: 131,044,487 probably benign Het
Drd2 G A 9: 49,402,212 R227H probably damaging Het
Dscc1 C A 15: 55,086,764 C195F probably damaging Het
Dzip1 T A 14: 118,922,713 M28L probably benign Het
Edar A T 10: 58,607,366 S313T probably benign Het
Eef1e1 C A 13: 38,656,123 A69S probably damaging Het
Fbn1 A G 2: 125,301,929 V2760A probably benign Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Fgl1 C G 8: 41,210,459 A11P possibly damaging Het
Fras1 T C 5: 96,600,733 V689A probably benign Het
Fry T A 5: 150,380,859 D571E probably damaging Het
Gm11232 T A 4: 71,757,213 R104* probably null Het
Gm1527 A G 3: 28,918,050 I439V possibly damaging Het
Gm4922 C A 10: 18,783,892 G361* probably null Het
Gm7052 T A 17: 22,040,466 probably benign Het
Gm7534 T C 4: 134,196,833 D467G probably benign Het
Gpatch8 A T 11: 102,481,229 S494R unknown Het
Gria2 A T 3: 80,732,045 V220E possibly damaging Het
Grik4 G A 9: 42,521,122 H860Y probably benign Het
Gtpbp1 A C 15: 79,707,729 S93R probably damaging Het
Gucy2g C A 19: 55,215,036 probably benign Het
Hist1h2ae C A 13: 23,571,047 probably benign Het
Hmcn1 G A 1: 150,609,700 R4384C probably damaging Het
Hspa12b G C 2: 131,145,192 A678P probably damaging Het
Igsf21 T A 4: 140,028,124 N407Y probably damaging Het
Insig2 A G 1: 121,307,156 Y174H probably benign Het
Itpr3 T A 17: 27,118,372 M2413K probably benign Het
Kalrn A T 16: 34,174,487 I1322N probably damaging Het
Klk1b24 T A 7: 44,191,466 M106K possibly damaging Het
Krt81 G T 15: 101,460,317 Q352K probably benign Het
Lca5l A T 16: 96,159,859 S468T possibly damaging Het
Lvrn T C 18: 46,882,385 probably benign Het
Mcpt1 T A 14: 56,019,164 probably benign Het
Med13l T C 5: 118,738,459 M900T probably benign Het
Med16 A G 10: 79,907,478 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mep1a T C 17: 43,491,672 H154R probably damaging Het
Mrc2 A T 11: 105,337,772 D659V probably benign Het
Mroh8 T A 2: 157,221,304 E799V probably damaging Het
Mrpl21 A G 19: 3,284,808 Y50C possibly damaging Het
Msl1 A G 11: 98,803,982 probably benign Het
Myo1a C A 10: 127,719,937 Q932K probably benign Het
Nav3 A C 10: 109,720,044 S1675R probably damaging Het
Neurl2 A G 2: 164,832,746 V232A possibly damaging Het
Nfatc1 T A 18: 80,665,267 probably benign Het
Odf3l2 A T 10: 79,645,558 probably benign Het
Olfr1362 C T 13: 21,611,822 C49Y probably benign Het
Olfr175-ps1 T A 16: 58,824,676 E11V probably null Het
P4hb A G 11: 120,562,555 probably benign Het
Papss1 T G 3: 131,605,854 I281S probably damaging Het
Pde10a A T 17: 8,964,708 D832V probably damaging Het
Pfkfb2 A T 1: 130,708,190 Y35N possibly damaging Het
Phf20l1 T A 15: 66,604,813 F253Y probably damaging Het
Pkhd1l1 G A 15: 44,516,115 V1046I probably benign Het
Plin3 C T 17: 56,284,337 A148T probably benign Het
Ppp1r8 T C 4: 132,840,631 probably benign Het
Ppp2r3a A G 9: 101,211,312 L604P probably damaging Het
Prdm5 T C 6: 65,883,601 V239A probably damaging Het
Prickle1 A G 15: 93,500,638 S770P probably damaging Het
Prl2c5 T A 13: 13,190,725 I155N probably benign Het
Prom1 T C 5: 44,032,932 probably benign Het
Psg25 C T 7: 18,529,587 G104R probably damaging Het
Rbm19 T C 5: 120,144,029 V817A probably benign Het
Ryr2 T A 13: 11,727,022 Y2091F probably damaging Het
Slc16a4 A G 3: 107,300,932 T253A probably benign Het
Smg7 A T 1: 152,855,843 probably null Het
Spink5 C A 18: 44,007,719 H662N probably benign Het
Taf2 A T 15: 55,059,915 M322K probably damaging Het
Tmc2 T C 2: 130,248,762 F676S probably damaging Het
Tmem177 A G 1: 119,910,185 S255P possibly damaging Het
Trim46 A T 3: 89,235,068 probably null Het
Tubb1 T A 2: 174,450,803 probably null Het
Upf1 T C 8: 70,344,254 T110A probably benign Het
Vmn2r9 T A 5: 108,848,984 I140L probably benign Het
Zfp638 T A 6: 83,944,656 H588Q probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 unclassified probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7113:Cic UTSW 7 25273444 missense probably benign 0.08
V7732:Cic UTSW 7 25292245 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCGGCTAGTGGAAAATCTCGTG -3'
(R):5'- GCTTTAGCCCAAAACTAAGTAGCTCCC -3'

Sequencing Primer
(F):5'- TAGCTTGGCGCACACTGAC -3'
(R):5'- CTAAGTAGCTCCCAACAAAACAC -3'
Posted On2014-10-30