Mutagenetix > Incidental Mutation

Incidental Mutation 'R6283:Cic'

508046

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

044453-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R6283 (G1)

Quality Score

110.008

Status

Validated

Chromosome

Chromosomal Location

24967129-24993584 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24985459 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 301 (S301L)

Ref Sequence

ENSEMBL: ENSMUSP00000128071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000165239] [ENSMUST00000169266]

AlphaFold

Q924A2

Predicted Effect

probably damaging
Transcript: ENSMUST00000005578
AA Change: S301L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: S301L

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163320
AA Change: S301L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: S301L

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164440

Predicted Effect

probably damaging
Transcript: ENSMUST00000165239
AA Change: S301L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: S301L

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167379

Predicted Effect

probably damaging
Transcript: ENSMUST00000169266
AA Change: S1208L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: S1208L

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168956

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169743

Meta Mutation Damage Score

0.0768

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsf3	C	A	8: 123,512,694 (GRCm39)	R372S	probably damaging	Het
Adamts20	A	G	15: 94,249,602 (GRCm39)	S472P	probably benign	Het
Bhlhe40	T	C	6: 108,641,992 (GRCm39)	L312P	probably damaging	Het
Ccdc180	A	G	4: 45,902,486 (GRCm39)	E305G	possibly damaging	Het
Ccdc83	T	A	7: 89,885,615 (GRCm39)	R257*	probably null	Het
Cd209e	G	A	8: 3,899,212 (GRCm39)	Q167*	probably null	Het
Cd300e	G	A	11: 114,945,380 (GRCm39)	T138I	probably benign	Het
Ces2c	A	T	8: 105,576,331 (GRCm39)	M115L	probably benign	Het
Cfap61	T	A	2: 145,971,022 (GRCm39)		probably null	Het
Chd1l	G	A	3: 97,494,483 (GRCm39)	A399V	probably damaging	Het
Cks2	A	G	13: 51,799,495 (GRCm39)	H16R	probably benign	Het
Copa	A	T	1: 171,946,415 (GRCm39)	H953L	possibly damaging	Het
Ctdsp2	T	C	10: 126,831,749 (GRCm39)	V145A	possibly damaging	Het
Cyp2j13	A	G	4: 95,945,074 (GRCm39)	V377A	possibly damaging	Het
Dhx57	A	G	17: 80,582,234 (GRCm39)	V404A	probably benign	Het
Dock2	T	C	11: 34,598,152 (GRCm39)	S340G	probably damaging	Het
Ggps1	A	G	13: 14,232,379 (GRCm39)		probably null	Het
Gm10549	C	A	18: 33,597,358 (GRCm39)		probably benign	Het
Gm11444	T	C	11: 85,737,617 (GRCm39)		probably null	Het
Grina	A	G	15: 76,132,751 (GRCm39)	T173A	possibly damaging	Het
Hcrtr1	G	A	4: 130,029,133 (GRCm39)	T223I	probably benign	Het
Igsf10	T	A	3: 59,226,870 (GRCm39)	T2268S	probably damaging	Het
Inhca	G	A	9: 103,159,834 (GRCm39)	R14*	probably null	Het
Ino80d	C	T	1: 63,101,285 (GRCm39)	R447Q	probably damaging	Het
Inpp4b	C	T	8: 82,497,462 (GRCm39)	T94M	probably damaging	Het
Itga2	A	G	13: 115,005,786 (GRCm39)	Y465H	probably damaging	Het
Knl1	A	G	2: 118,900,767 (GRCm39)	T823A	probably damaging	Het
Krtap4-16	A	G	11: 99,741,861 (GRCm39)	S180P	unknown	Het
Ldc1	A	G	4: 130,115,534 (GRCm39)	S5P	probably benign	Het
Lpar6	A	T	14: 73,476,297 (GRCm39)	D86V	probably damaging	Het
Muc5ac	C	A	7: 141,370,601 (GRCm39)	C2500*	probably null	Het
Mzf1	T	C	7: 12,787,296 (GRCm39)		probably benign	Het
Or4f58	A	C	2: 111,851,605 (GRCm39)	M198R	possibly damaging	Het
Or5d46	T	A	2: 88,170,002 (GRCm39)	I31N	probably benign	Het
Or5m3	G	T	2: 85,838,443 (GRCm39)	V108L	possibly damaging	Het
Or7a36	T	C	10: 78,820,113 (GRCm39)	V163A	probably benign	Het
Otogl	T	G	10: 107,626,361 (GRCm39)	E1501A	probably damaging	Het
Pcdh10	T	A	3: 45,335,989 (GRCm39)	S768T	possibly damaging	Het
Pcnx2	G	T	8: 126,604,325 (GRCm39)	Q644K	probably damaging	Het
Pdzd9	T	A	7: 120,259,449 (GRCm39)	I180F	possibly damaging	Het
Pinx1	A	C	14: 64,115,621 (GRCm39)	N152T	probably benign	Het
Prr14l	T	C	5: 32,987,608 (GRCm39)	E629G	probably benign	Het
Qpctl	T	A	7: 18,882,345 (GRCm39)	I104F	probably benign	Het
Rabep1	C	T	11: 70,808,505 (GRCm39)	A444V	probably damaging	Het
Rnf150	A	G	8: 83,717,183 (GRCm39)	Y230C	probably damaging	Het
Slc25a27	A	C	17: 43,968,621 (GRCm39)	V152G	probably damaging	Het
Swt1	A	G	1: 151,260,084 (GRCm39)	S772P	possibly damaging	Het
Tenm4	A	G	7: 96,523,701 (GRCm39)	T1711A	probably benign	Het
Tfap2d	G	C	1: 19,174,702 (GRCm39)	G52R	probably benign	Het
Tmem265	T	G	7: 127,164,044 (GRCm39)	V86G	possibly damaging	Het
Trpm8	C	T	1: 88,276,054 (GRCm39)	H551Y	probably benign	Het
Ttc6	T	G	12: 57,749,048 (GRCm39)	Y1327D	possibly damaging	Het
Uevld	G	T	7: 46,587,729 (GRCm39)	Q324K	possibly damaging	Het
Vmn2r111	T	C	17: 22,778,032 (GRCm39)	N549S	possibly damaging	Het
Vmn2r73	C	T	7: 85,521,049 (GRCm39)	M306I	probably benign	Het
Vmn2r93	T	A	17: 18,524,366 (GRCm39)	M120K	probably benign	Het
Zfp804b	T	A	5: 6,819,908 (GRCm39)	I1016F	probably benign	Het
Zfp90	T	C	8: 107,152,026 (GRCm39)	C580R	probably damaging	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	24,991,549 (GRCm39)	missense	probably damaging	1.00
IGL01668:Cic	APN	7	24,990,629 (GRCm39)	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	24,990,375 (GRCm39)	missense	probably damaging	0.96
IGL02506:Cic	APN	7	24,990,282 (GRCm39)	missense	probably benign
IGL02794:Cic	APN	7	24,985,069 (GRCm39)	missense	probably damaging	1.00
IGL03065:Cic	APN	7	24,985,246 (GRCm39)	splice site	probably benign
IGL03304:Cic	APN	7	24,984,274 (GRCm39)	missense	probably damaging	1.00
Capuccino	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
Cassock	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
Monkey	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R4850_Cic_466	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
1mM(1):Cic	UTSW	7	24,990,214 (GRCm39)	splice site	probably benign
IGL03046:Cic	UTSW	7	24,990,500 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0027:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0027:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0038:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0038:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0063:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0063:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0064:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0064:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0118:Cic	UTSW	7	24,985,459 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0241:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0241:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0377:Cic	UTSW	7	24,985,224 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0800:Cic	UTSW	7	24,984,662 (GRCm39)	missense	probably benign
R1253:Cic	UTSW	7	24,990,373 (GRCm39)	missense	probably damaging	1.00
R1458:Cic	UTSW	7	24,979,162 (GRCm39)	intron	probably benign
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1519:Cic	UTSW	7	24,993,235 (GRCm39)	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	24,985,386 (GRCm39)	missense	probably damaging	1.00
R1824:Cic	UTSW	7	24,987,691 (GRCm39)	missense	probably damaging	1.00
R1908:Cic	UTSW	7	24,986,265 (GRCm39)	missense	probably damaging	1.00
R2045:Cic	UTSW	7	24,970,961 (GRCm39)	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	24,972,876 (GRCm39)	missense	probably damaging	0.98
R2161:Cic	UTSW	7	24,987,559 (GRCm39)	splice site	probably null
R2495:Cic	UTSW	7	24,991,201 (GRCm39)	splice site	probably benign
R2865:Cic	UTSW	7	24,972,646 (GRCm39)	missense	probably damaging	0.96
R3692:Cic	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
R3709:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3710:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3872:Cic	UTSW	7	24,971,124 (GRCm39)	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	24,971,771 (GRCm39)	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4426:Cic	UTSW	7	24,993,433 (GRCm39)	utr 3 prime	probably benign
R4502:Cic	UTSW	7	24,987,892 (GRCm39)	missense	probably damaging	1.00
R4585:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4586:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4614:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4664:Cic	UTSW	7	24,990,099 (GRCm39)	small deletion	probably benign
R4688:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4695:Cic	UTSW	7	24,973,013 (GRCm39)	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	24,987,908 (GRCm39)	missense	probably benign
R4746:Cic	UTSW	7	24,987,905 (GRCm39)	missense	probably damaging	1.00
R4758:Cic	UTSW	7	24,991,636 (GRCm39)	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	24,971,025 (GRCm39)	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	24,982,308 (GRCm39)	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	24,971,157 (GRCm39)	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4851:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4922:Cic	UTSW	7	24,991,095 (GRCm39)	small insertion	probably benign
R4989:Cic	UTSW	7	24,986,535 (GRCm39)	missense	probably damaging	1.00
R5131:Cic	UTSW	7	24,991,095 (GRCm39)	small insertion	probably benign
R5718:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R5801:Cic	UTSW	7	24,970,863 (GRCm39)	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	24,971,730 (GRCm39)	missense	probably damaging	1.00
R6000:Cic	UTSW	7	24,971,423 (GRCm39)	missense	probably benign	0.33
R6246:Cic	UTSW	7	24,971,067 (GRCm39)	missense	probably damaging	1.00
R6364:Cic	UTSW	7	24,972,248 (GRCm39)	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	24,987,706 (GRCm39)	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	24,971,202 (GRCm39)	missense	probably benign	0.04
R6920:Cic	UTSW	7	24,990,107 (GRCm39)	missense	probably damaging	1.00
R6995:Cic	UTSW	7	24,970,736 (GRCm39)	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	24,971,621 (GRCm39)	missense	probably damaging	0.99
R7113:Cic	UTSW	7	24,972,869 (GRCm39)	missense	probably benign	0.08
R7560:Cic	UTSW	7	24,972,278 (GRCm39)	missense	probably damaging	0.98
R7680:Cic	UTSW	7	24,991,856 (GRCm39)	missense	probably damaging	0.96
R7698:Cic	UTSW	7	24,972,597 (GRCm39)	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	24,988,207 (GRCm39)	missense	probably damaging	1.00
R7841:Cic	UTSW	7	24,985,192 (GRCm39)	missense	probably damaging	1.00
R7879:Cic	UTSW	7	24,984,551 (GRCm39)	missense	probably benign	0.10
R7916:Cic	UTSW	7	24,987,715 (GRCm39)	missense	probably damaging	0.99
R7920:Cic	UTSW	7	24,971,384 (GRCm39)	missense	probably benign
R8056:Cic	UTSW	7	24,990,366 (GRCm39)	missense	possibly damaging	0.90
R8226:Cic	UTSW	7	24,987,213 (GRCm39)	missense	probably damaging	1.00
R8281:Cic	UTSW	7	24,971,249 (GRCm39)	missense	probably benign
R8847:Cic	UTSW	7	24,970,631 (GRCm39)	missense	probably damaging	0.98
R8991:Cic	UTSW	7	24,988,885 (GRCm39)	missense	probably damaging	1.00
R9083:Cic	UTSW	7	24,985,470 (GRCm39)	missense	probably damaging	0.99
R9140:Cic	UTSW	7	24,985,165 (GRCm39)	missense	probably damaging	0.99
R9200:Cic	UTSW	7	24,971,940 (GRCm39)	missense	probably damaging	0.99
R9208:Cic	UTSW	7	24,987,502 (GRCm39)	missense	probably benign	0.07
R9301:Cic	UTSW	7	24,991,117 (GRCm39)	missense	probably damaging	1.00
R9408:Cic	UTSW	7	24,971,414 (GRCm39)	missense	possibly damaging	0.70
R9569:Cic	UTSW	7	24,972,120 (GRCm39)	missense	possibly damaging	0.85
R9752:Cic	UTSW	7	24,971,403 (GRCm39)	missense	probably damaging	0.96
V7732:Cic	UTSW	7	24,991,670 (GRCm39)	missense	probably benign
Z1176:Cic	UTSW	7	24,970,444 (GRCm39)	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AATACCACGACCTGGCCTTC -3'
(R):5'- AGTGCTCAGTAAATGGCAGG -3'

Sequencing Primer
(F):5'- GGCCTTCCAGGTAATCTTTCC -3'
(R):5'- GCAGGAGGTAACAACTTGTATTTG -3'

Posted On

2018-03-15