Incidental Mutation 'R3885:Lrriq1'
ID308715
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 040905-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R3885 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103216106 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 262 (I262V)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
Predicted Effect probably damaging
Transcript: ENSMUST00000020043
AA Change: I262V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: I262V

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123364
AA Change: I262V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: I262V

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166240
AA Change: I262V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: I262V

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220380
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak8 G A 2: 28,733,885 V161I possibly damaging Het
Ank3 A T 10: 69,899,036 I792F probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Boc T C 16: 44,487,613 probably benign Het
Bptf G A 11: 107,074,513 T1170M probably damaging Het
Ccdc85a T A 11: 28,576,677 E310D probably benign Het
Cfap221 A G 1: 119,954,146 probably null Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Eif2ak1 A T 5: 143,884,661 Q265L probably benign Het
Eif2s1 T A 12: 78,881,225 I225N probably damaging Het
Ephb2 C T 4: 136,771,034 G245S probably damaging Het
Exoc4 T C 6: 33,266,131 probably null Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Gck T C 11: 5,910,318 Y108C probably damaging Het
Gjc3 T A 5: 137,957,843 N60I possibly damaging Het
Gm5145 A T 17: 20,571,010 T217S probably benign Het
Gpc5 T C 14: 115,370,060 M358T probably benign Het
Gpr150 T C 13: 76,056,538 Q96R probably damaging Het
Hist1h2ae G T 13: 23,570,879 T77K possibly damaging Het
Hist1h2an A G 13: 21,786,869 L117P probably damaging Het
Itga2 A T 13: 114,869,299 H448Q probably benign Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lrch2 C G X: 147,473,007 A437P probably damaging Het
Mgst3 G T 1: 167,372,562 Q135K probably benign Het
Nrxn1 T A 17: 90,623,471 T766S probably damaging Het
Olfr736 A T 14: 50,392,869 I38F probably benign Het
Ovch2 A G 7: 107,796,568 I81T probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,759,610 N236Y probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Senp7 A G 16: 56,186,079 E922G probably damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Steap4 G T 5: 7,980,494 R450L probably damaging Het
Usp40 A T 1: 87,967,269 L843Q probably damaging Het
Vmn2r97 C T 17: 18,928,334 L164F possibly damaging Het
Wiz G T 17: 32,357,038 A798E possibly damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTAATGATCAGTGGCG -3'
(R):5'- TCCCAGTGAGACCCAAATCTTC -3'

Sequencing Primer
(F):5'- AGTGGGCATGTTCCCTCAGTC -3'
(R):5'- AGCACTTTCACCCGTCAT -3'
Posted On2015-04-17