Incidental Mutation 'R4097:Cttnbp2'
ID317165
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 040984-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R4097 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18420872 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 370 (E370G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000148602]
Predicted Effect probably benign
Transcript: ENSMUST00000090601
AA Change: E880G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: E880G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137958
Predicted Effect probably benign
Transcript: ENSMUST00000146775
AA Change: E370G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416
AA Change: E370G

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148602
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152499
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,512,364 F292L probably damaging Het
Ankrd36 A G 11: 5,628,703 D664G possibly damaging Het
Bbs1 T A 19: 4,897,317 Y358F probably damaging Het
Becn1 C T 11: 101,294,266 probably benign Het
Cenpp A T 13: 49,493,789 N47I possibly damaging Het
Clec4n A T 6: 123,230,741 H55L possibly damaging Het
Cntnap4 A G 8: 112,752,307 I222V probably benign Het
Cyp4a10 T A 4: 115,529,283 V413E probably damaging Het
Dctn2 C T 10: 127,277,493 L249F probably damaging Het
Dnah9 T C 11: 65,990,459 S146G probably damaging Het
Dzip3 A T 16: 48,958,489 L315* probably null Het
Evpl T C 11: 116,223,177 E1229G possibly damaging Het
Ice2 T C 9: 69,421,671 V775A possibly damaging Het
Jmjd1c A G 10: 67,219,008 E69G probably benign Het
Lrrc66 T A 5: 73,607,704 R665S possibly damaging Het
Mpdz T A 4: 81,335,700 H1065L probably damaging Het
Nrf1 C T 6: 30,151,672 Q503* probably null Het
Nt5dc3 G A 10: 86,833,956 A472T probably benign Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Pramel6 T G 2: 87,509,353 F154V probably benign Het
Ralb T C 1: 119,483,498 D37G probably benign Het
Ranbp9 A T 13: 43,421,257 Y412N probably damaging Het
Scg2 T A 1: 79,435,821 D395V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpine3 T A 14: 62,670,946 L141Q probably damaging Het
Sgpl1 C T 10: 61,103,238 G394D probably damaging Het
Sh3pxd2a T C 19: 47,424,512 Y44C probably damaging Het
Slc6a20b A G 9: 123,612,757 probably benign Het
Snapc5 T C 9: 64,180,527 I40T probably damaging Het
Spopl T C 2: 23,511,401 H365R probably benign Het
Stil T A 4: 115,023,600 I447N probably benign Het
Taf3 C A 2: 9,952,367 V330F possibly damaging Het
Tgoln1 T C 6: 72,615,801 E232G probably damaging Het
Thrap3 A G 4: 126,171,802 L729P probably damaging Het
Tmem269 A T 4: 119,205,780 F220Y probably damaging Het
Tnrc18 ATCTTCC A 5: 142,773,806 probably benign Het
Ubxn6 T C 17: 56,069,712 T227A probably benign Het
Wdr17 C A 8: 54,635,469 R1182I probably damaging Het
Wdr26 T C 1: 181,182,787 I550V probably benign Het
Wdr43 A G 17: 71,657,537 N637S probably benign Het
Zfp516 A G 18: 82,987,256 T762A possibly damaging Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense not run
R7141:Cttnbp2 UTSW 6 18380468 missense not run
Predicted Primers PCR Primer
(F):5'- AGTCAGTTTGTAGCAGCAGC -3'
(R):5'- CCTCCATTTCCTGATGAGGTGG -3'

Sequencing Primer
(F):5'- AGCTCCTGGCCTTCTGCAAAG -3'
(R):5'- GGTGGACTCAAAATAACACAGTTCTC -3'
Posted On2015-05-15