Incidental Mutation 'R4211:Nek8'
ID319207
Institutional Source Beutler Lab
Gene Symbol Nek8
Ensembl Gene ENSMUSG00000017405
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 8
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78166106-78176675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78170483 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 379 (V379L)
Ref Sequence ENSEMBL: ENSMUSP00000017549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017530] [ENSMUST00000017549] [ENSMUST00000148154]
Predicted Effect probably benign
Transcript: ENSMUST00000017530
SMART Domains Protein: ENSMUSP00000017530
Gene: ENSMUSG00000017386

DomainStartEndE-ValueType
RING 18 57 1.41e-4 SMART
Pfam:zf-TRAF 102 156 3.4e-19 PFAM
Pfam:zf-TRAF 156 210 4e-12 PFAM
Pfam:zf-TRAF 210 269 4.2e-23 PFAM
low complexity region 287 302 N/A INTRINSIC
MATH 312 445 1.04e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000017549
AA Change: V379L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017549
Gene: ENSMUSG00000017405
AA Change: V379L

DomainStartEndE-ValueType
S_TKc 4 258 1.59e-81 SMART
low complexity region 288 316 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Pfam:RCC1 415 464 4.1e-12 PFAM
Pfam:RCC1_2 451 480 9.2e-10 PFAM
Pfam:RCC1 467 516 9.9e-16 PFAM
Pfam:RCC1 585 634 4.4e-15 PFAM
Pfam:RCC1 637 687 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147798
Predicted Effect probably benign
Transcript: ENSMUST00000148154
SMART Domains Protein: ENSMUSP00000127554
Gene: ENSMUSG00000017405

DomainStartEndE-ValueType
Pfam:Pkinase 1 103 4.1e-20 PFAM
Pfam:Pkinase_Tyr 1 103 3.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152611
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a NIMA-related kinase. Members of this serine/threonine protein kinase family are structurally-related to NIMA (never in mitosis, gene A) which controls mitotic signaling in Aspergillus nidulans. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display kidney cysts primarily in the cortex, progressive kidney enlargement, increased serum creatinine levels, impaired maternal nurturing, and premature death. Heterotaxy with congenital heart disease such as hypoplastic right ventricle and small tricuspid valve is seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Nek8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nek8 APN 11 78167827 missense probably damaging 0.96
IGL00914:Nek8 APN 11 78173075 missense possibly damaging 0.80
nerkkod UTSW 11 78173059 missense probably damaging 1.00
R0136:Nek8 UTSW 11 78171207 missense probably benign 0.01
R0490:Nek8 UTSW 11 78167729 missense probably benign 0.01
R0657:Nek8 UTSW 11 78171207 missense probably benign 0.01
R1033:Nek8 UTSW 11 78171285 missense probably null 1.00
R2848:Nek8 UTSW 11 78168141 missense probably damaging 1.00
R3406:Nek8 UTSW 11 78170746 nonsense probably null
R4810:Nek8 UTSW 11 78167803 missense probably benign 0.00
R4811:Nek8 UTSW 11 78167718 splice site probably null
R5108:Nek8 UTSW 11 78172527 missense probably damaging 0.96
R5124:Nek8 UTSW 11 78172939 missense probably damaging 1.00
R5177:Nek8 UTSW 11 78170471 nonsense probably null
R5212:Nek8 UTSW 11 78172516 start codon destroyed probably null 0.02
R5386:Nek8 UTSW 11 78170437 unclassified probably null
R5921:Nek8 UTSW 11 78173059 missense probably damaging 1.00
R5977:Nek8 UTSW 11 78167825 missense probably benign 0.01
X0026:Nek8 UTSW 11 78168105 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAGATGAGAGAAGTTACACTGTCTG -3'
(R):5'- AGGTTGCCAATGCTCAACAC -3'

Sequencing Primer
(F):5'- AGAGAAGTTACACTGTCTGGCTTCC -3'
(R):5'- ATGCTCAACACGGAGGTGGTC -3'
Posted On2015-06-10