Incidental Mutation 'R4685:Itgb2'
ID353616
Institutional Source Beutler Lab
Gene Symbol Itgb2
Ensembl Gene ENSMUSG00000000290
Gene Nameintegrin beta 2
SynonymsMac-1 beta, Cd18, 2E6
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R4685 (G1)
Quality Score205
Status Validated
Chromosome10
Chromosomal Location77530252-77565708 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 77550103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000299] [ENSMUST00000130059] [ENSMUST00000131023] [ENSMUST00000153541] [ENSMUST00000156644]
Predicted Effect probably null
Transcript: ENSMUST00000000299
SMART Domains Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
internal_repeat_1 459 509 7.99e-5 PROSPERO
EGF_like 535 574 6.81e1 SMART
Integrin_B_tail 622 701 5.53e-22 SMART
transmembrane domain 702 724 N/A INTRINSIC
Integrin_b_cyt 725 770 1.58e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130059
SMART Domains Protein: ENSMUSP00000118191
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
INB 1 130 2.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131023
SMART Domains Protein: ENSMUSP00000119657
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
Pfam:Integrin_beta 2 54 7.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153541
SMART Domains Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156644
SMART Domains Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:2P28|A 23 49 9e-12 PDB
Blast:PSI 24 49 2e-11 BLAST
Meta Mutation Damage Score 0.486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Itgb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Itgb2 APN 10 77557406 missense probably damaging 1.00
IGL00427:Itgb2 APN 10 77557956 missense probably benign 0.13
IGL00500:Itgb2 APN 10 77564724 missense probably damaging 1.00
IGL01019:Itgb2 APN 10 77542403 missense possibly damaging 0.94
IGL01104:Itgb2 APN 10 77547194 splice site probably null
IGL01111:Itgb2 APN 10 77542000 missense probably damaging 0.98
IGL01574:Itgb2 APN 10 77557964 missense possibly damaging 0.82
IGL02087:Itgb2 APN 10 77559696 missense possibly damaging 0.94
IGL02132:Itgb2 APN 10 77550061 missense probably damaging 1.00
IGL02325:Itgb2 APN 10 77547192 missense probably damaging 1.00
IGL02505:Itgb2 APN 10 77547218 missense probably damaging 1.00
IGL02590:Itgb2 APN 10 77559513 missense probably damaging 1.00
IGL02735:Itgb2 APN 10 77549999 missense possibly damaging 0.81
barely UTSW 10 77548536 splice site probably benign
joker UTSW 10 77549849 intron probably benign
newhome UTSW 10 77559681 missense probably benign 0.00
nibbler UTSW 10 77561216 critical splice donor site probably null
Only_just UTSW 10 77549968 missense possibly damaging 0.80
R0217:Itgb2 UTSW 10 77548536 splice site probably benign
R0394:Itgb2 UTSW 10 77542475 missense probably damaging 1.00
R0396:Itgb2 UTSW 10 77561189 missense probably damaging 0.97
R1425:Itgb2 UTSW 10 77547296 missense probably null 1.00
R1499:Itgb2 UTSW 10 77546153 missense possibly damaging 0.62
R1542:Itgb2 UTSW 10 77559486 missense probably benign
R1803:Itgb2 UTSW 10 77564790 missense probably benign 0.15
R1889:Itgb2 UTSW 10 77548623 missense possibly damaging 0.74
R2035:Itgb2 UTSW 10 77547199 missense probably damaging 1.00
R2156:Itgb2 UTSW 10 77560248 missense probably benign 0.01
R2374:Itgb2 UTSW 10 77559681 missense probably benign 0.00
R3769:Itgb2 UTSW 10 77549968 missense possibly damaging 0.80
R3942:Itgb2 UTSW 10 77558033 missense probably benign 0.31
R4352:Itgb2 UTSW 10 77556167 missense probably benign 0.10
R4537:Itgb2 UTSW 10 77561216 critical splice donor site probably null
R4600:Itgb2 UTSW 10 77546115 missense probably benign
R4611:Itgb2 UTSW 10 77550050 missense probably damaging 1.00
R4717:Itgb2 UTSW 10 77546044 nonsense probably null
R5068:Itgb2 UTSW 10 77548761 missense probably damaging 1.00
R5297:Itgb2 UTSW 10 77564667 missense probably damaging 1.00
R5355:Itgb2 UTSW 10 77558052 missense probably benign
R5927:Itgb2 UTSW 10 77546034 missense probably damaging 1.00
R6371:Itgb2 UTSW 10 77548597 missense probably damaging 1.00
R6505:Itgb2 UTSW 10 77559673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACTCTTCTCCCCTGAGG -3'
(R):5'- CTCATGTTATCACCAGGGTCTC -3'

Sequencing Primer
(F):5'- AGGTAACCCCTGGATGCCTTC -3'
(R):5'- AGGGTCTCTGGGACTGCATC -3'
Posted On2015-10-21