Incidental Mutation 'R4819:Pcnx2'
ID370056
Institutional Source Beutler Lab
Gene Symbol Pcnx2
Ensembl Gene ENSMUSG00000060212
Gene Namepecanex homolog 2
SynonymsPcnxl2, E330039K12Rik
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125751508-125898317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125855230 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 922 (F922L)
Ref Sequence ENSEMBL: ENSMUSP00000119965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047239] [ENSMUST00000131127]
Predicted Effect probably benign
Transcript: ENSMUST00000047239
AA Change: F922L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: F922L

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 881 902 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 976 998 N/A INTRINSIC
transmembrane domain 1011 1030 N/A INTRINSIC
transmembrane domain 1080 1102 N/A INTRINSIC
transmembrane domain 1104 1126 N/A INTRINSIC
Pfam:Pecanex_C 1603 1828 3.5e-113 PFAM
low complexity region 1864 1889 N/A INTRINSIC
low complexity region 1968 1981 N/A INTRINSIC
low complexity region 2004 2019 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131127
AA Change: F922L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119965
Gene: ENSMUSG00000060212
AA Change: F922L

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 391 415 N/A INTRINSIC
low complexity region 457 476 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
transmembrane domain 849 866 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 968 990 N/A INTRINSIC
transmembrane domain 1010 1029 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Pcnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcnx2 APN 8 125887585 missense probably damaging 1.00
IGL00900:Pcnx2 APN 8 125863236 splice site probably benign
IGL01134:Pcnx2 APN 8 125863150 missense probably benign
IGL01370:Pcnx2 APN 8 125801483 missense probably damaging 0.96
IGL01452:Pcnx2 APN 8 125838032 missense probably damaging 1.00
IGL01477:Pcnx2 APN 8 125785305 missense probably damaging 1.00
IGL01610:Pcnx2 APN 8 125839633 missense possibly damaging 0.67
IGL01640:Pcnx2 APN 8 125801558 missense probably benign 0.14
IGL01645:Pcnx2 APN 8 125887917 missense probably damaging 1.00
IGL01876:Pcnx2 APN 8 125866031 missense probably benign 0.31
IGL01933:Pcnx2 APN 8 125761654 missense probably damaging 1.00
IGL02208:Pcnx2 APN 8 125752155 missense probably benign 0.30
IGL02573:Pcnx2 APN 8 125855273 missense probably benign 0.34
IGL02810:Pcnx2 APN 8 125887203 missense probably benign 0.03
IGL02859:Pcnx2 APN 8 125863173 missense probably damaging 1.00
IGL02879:Pcnx2 APN 8 125772057 missense probably damaging 1.00
IGL03202:Pcnx2 APN 8 125772044 missense probably damaging 0.98
IGL03259:Pcnx2 APN 8 125753649 missense probably benign 0.19
IGL03395:Pcnx2 APN 8 125887523 missense probably benign 0.00
IGL03410:Pcnx2 APN 8 125887040 missense probably damaging 1.00
R0107:Pcnx2 UTSW 8 125753586 missense probably benign 0.29
R0477:Pcnx2 UTSW 8 125761567 missense probably damaging 0.99
R0610:Pcnx2 UTSW 8 125839687 missense probably damaging 1.00
R0645:Pcnx2 UTSW 8 125760720 missense possibly damaging 0.64
R0894:Pcnx2 UTSW 8 125886926 splice site probably benign
R1083:Pcnx2 UTSW 8 125772104 missense probably damaging 1.00
R1199:Pcnx2 UTSW 8 125887314 missense possibly damaging 0.60
R1296:Pcnx2 UTSW 8 125773833 missense probably damaging 1.00
R1445:Pcnx2 UTSW 8 125752284 missense probably damaging 0.99
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1467:Pcnx2 UTSW 8 125753550 missense possibly damaging 0.77
R1524:Pcnx2 UTSW 8 125891141 missense probably benign 0.00
R1537:Pcnx2 UTSW 8 125877449 missense possibly damaging 0.94
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1574:Pcnx2 UTSW 8 125773930 missense probably damaging 1.00
R1593:Pcnx2 UTSW 8 125759273 missense probably benign 0.11
R1598:Pcnx2 UTSW 8 125772086 missense probably benign 0.03
R1603:Pcnx2 UTSW 8 125839626 missense probably damaging 1.00
R1697:Pcnx2 UTSW 8 125850348 missense probably damaging 1.00
R1759:Pcnx2 UTSW 8 125773978 missense probably damaging 1.00
R1855:Pcnx2 UTSW 8 125807996 splice site probably benign
R1863:Pcnx2 UTSW 8 125818786 missense probably damaging 0.98
R1930:Pcnx2 UTSW 8 125887714 missense probably benign 0.10
R1967:Pcnx2 UTSW 8 125815683 missense possibly damaging 0.51
R1974:Pcnx2 UTSW 8 125887371 missense probably benign 0.00
R1998:Pcnx2 UTSW 8 125887143 missense probably damaging 1.00
R2034:Pcnx2 UTSW 8 125818667 critical splice donor site probably null
R2072:Pcnx2 UTSW 8 125761742 missense possibly damaging 0.90
R2096:Pcnx2 UTSW 8 125759248 missense probably benign 0.27
R2216:Pcnx2 UTSW 8 125888077 missense probably benign 0.00
R2290:Pcnx2 UTSW 8 125877595 splice site probably benign
R2373:Pcnx2 UTSW 8 125753451 missense probably damaging 1.00
R2484:Pcnx2 UTSW 8 125891120 missense probably damaging 1.00
R2849:Pcnx2 UTSW 8 125760927 missense probably damaging 1.00
R2891:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2892:Pcnx2 UTSW 8 125891058 missense probably damaging 1.00
R2970:Pcnx2 UTSW 8 125801536 missense probably damaging 1.00
R3013:Pcnx2 UTSW 8 125887770 missense probably benign 0.05
R3608:Pcnx2 UTSW 8 125888101 missense probably benign
R3876:Pcnx2 UTSW 8 125888158 missense probably benign
R4349:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4352:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4353:Pcnx2 UTSW 8 125762851 missense probably damaging 0.98
R4361:Pcnx2 UTSW 8 125768298 nonsense probably null
R4735:Pcnx2 UTSW 8 125828041 critical splice donor site probably null
R4749:Pcnx2 UTSW 8 125887588 missense probably damaging 1.00
R4812:Pcnx2 UTSW 8 125865939 missense probably benign 0.00
R4829:Pcnx2 UTSW 8 125861058 intron probably null
R4832:Pcnx2 UTSW 8 125752188 missense probably damaging 0.99
R4876:Pcnx2 UTSW 8 125772108 missense probably damaging 1.00
R4974:Pcnx2 UTSW 8 125851130 missense probably benign 0.00
R5057:Pcnx2 UTSW 8 125855191 missense possibly damaging 0.95
R5078:Pcnx2 UTSW 8 125752156 missense probably benign
R5114:Pcnx2 UTSW 8 125838010 missense possibly damaging 0.89
R5195:Pcnx2 UTSW 8 125801549 missense possibly damaging 0.69
R5239:Pcnx2 UTSW 8 125861082 intron probably null
R5348:Pcnx2 UTSW 8 125818756 missense probably damaging 1.00
R5398:Pcnx2 UTSW 8 125887948 missense possibly damaging 0.63
R5448:Pcnx2 UTSW 8 125888149 missense probably benign 0.14
R5534:Pcnx2 UTSW 8 125838015 missense possibly damaging 0.65
R5624:Pcnx2 UTSW 8 125761523 critical splice donor site probably null
R5629:Pcnx2 UTSW 8 125898041 missense probably damaging 1.00
R5630:Pcnx2 UTSW 8 125860958 missense probably damaging 0.99
R5782:Pcnx2 UTSW 8 125753484 missense probably damaging 1.00
R5877:Pcnx2 UTSW 8 125753728 missense probably damaging 0.99
R5879:Pcnx2 UTSW 8 125773946 missense probably damaging 1.00
R6114:Pcnx2 UTSW 8 125773947 missense probably damaging 1.00
R6152:Pcnx2 UTSW 8 125753752 missense probably damaging 0.99
R6154:Pcnx2 UTSW 8 125762813 missense probably damaging 1.00
R6283:Pcnx2 UTSW 8 125877586 missense probably damaging 0.99
R6500:Pcnx2 UTSW 8 125753485 missense probably damaging 1.00
R6629:Pcnx2 UTSW 8 125891112 missense probably benign 0.00
R6708:Pcnx2 UTSW 8 125860953 critical splice donor site probably null
R6736:Pcnx2 UTSW 8 125752317 splice site probably null
R6748:Pcnx2 UTSW 8 125850335 missense probably damaging 1.00
R6788:Pcnx2 UTSW 8 125772100 missense probably damaging 1.00
R6849:Pcnx2 UTSW 8 125861210 missense probably damaging 1.00
R6947:Pcnx2 UTSW 8 125850282 critical splice donor site probably null
Z1088:Pcnx2 UTSW 8 125826928 missense probably damaging 1.00
Z1088:Pcnx2 UTSW 8 125866018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAGCTCAGAGTCTTCTACAG -3'
(R):5'- GTGGTGTCATGGAGTCAAAAC -3'

Sequencing Primer
(F):5'- TCTTCTACAGACACAAGCCAAGAGG -3'
(R):5'- CAAAAGGTACAACTTGGAAATTGC -3'
Posted On2016-02-04