Incidental Mutation 'R0441:Vmn2r102'
ID39192
Institutional Source Beutler Lab
Gene Symbol Vmn2r102
Ensembl Gene ENSMUSG00000095961
Gene Namevomeronasal 2, receptor 102
SynonymsEG224572
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0441 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19660399-19694748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19694368 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 732 (I732F)
Ref Sequence ENSEMBL: ENSMUSP00000126559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171741]
Predicted Effect probably damaging
Transcript: ENSMUST00000171741
AA Change: I732F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126559
Gene: ENSMUSG00000095961
AA Change: I732F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 448 5.2e-38 PFAM
Pfam:NCD3G 509 562 1.1e-21 PFAM
Pfam:7tm_3 595 830 1.8e-53 PFAM
Meta Mutation Damage Score 0.0268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Agbl2 C T 2: 90,797,483 R211* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Ampd1 C G 3: 103,088,478 L235V probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Lrch1 C T 14: 74,947,545 G39D possibly damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1019 A T 2: 85,841,515 I92N probably damaging Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Otog T C 7: 46,305,877 S564P probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R502H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D187G probably damaging Het
Srgap2 G A 1: 131,336,437 T465I probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D78V probably damaging Het
Tpp2 A G 1: 43,990,562 N68D possibly damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in Vmn2r102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Vmn2r102 APN 17 19678892 missense probably damaging 1.00
IGL00974:Vmn2r102 APN 17 19677509 missense possibly damaging 0.93
IGL00978:Vmn2r102 APN 17 19678923 splice site probably null
IGL01589:Vmn2r102 APN 17 19678804 missense probably benign
IGL01738:Vmn2r102 APN 17 19677758 missense probably damaging 1.00
IGL01994:Vmn2r102 APN 17 19660469 missense probably benign 0.00
IGL02066:Vmn2r102 APN 17 19693929 missense probably benign 0.01
IGL02525:Vmn2r102 APN 17 19681185 missense probably benign
IGL02589:Vmn2r102 APN 17 19681218 missense probably damaging 1.00
IGL02814:Vmn2r102 APN 17 19677908 missense probably damaging 1.00
IGL03028:Vmn2r102 APN 17 19694066 missense possibly damaging 0.92
IGL03162:Vmn2r102 APN 17 19694024 missense probably damaging 1.00
PIT4431001:Vmn2r102 UTSW 17 19676696 missense possibly damaging 0.68
R0042:Vmn2r102 UTSW 17 19660589 missense probably damaging 0.98
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0132:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0268:Vmn2r102 UTSW 17 19677850 missense probably benign 0.00
R0583:Vmn2r102 UTSW 17 19676781 missense probably benign 0.01
R0600:Vmn2r102 UTSW 17 19678015 missense probably benign 0.00
R0606:Vmn2r102 UTSW 17 19678844 missense possibly damaging 0.93
R0674:Vmn2r102 UTSW 17 19677867 missense probably benign 0.00
R0709:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R0879:Vmn2r102 UTSW 17 19694192 missense probably damaging 1.00
R1349:Vmn2r102 UTSW 17 19660625 splice site probably benign
R1473:Vmn2r102 UTSW 17 19694581 missense probably benign 0.00
R1630:Vmn2r102 UTSW 17 19678770 missense possibly damaging 0.60
R1727:Vmn2r102 UTSW 17 19677508 missense probably damaging 0.99
R1759:Vmn2r102 UTSW 17 19694493 missense probably damaging 1.00
R1809:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R2013:Vmn2r102 UTSW 17 19676744 missense probably benign 0.03
R2086:Vmn2r102 UTSW 17 19676687 missense probably damaging 1.00
R2241:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R2378:Vmn2r102 UTSW 17 19694668 missense probably damaging 1.00
R3814:Vmn2r102 UTSW 17 19678831 missense probably damaging 0.98
R3827:Vmn2r102 UTSW 17 19694525 missense probably damaging 1.00
R4159:Vmn2r102 UTSW 17 19677826 missense probably damaging 1.00
R4505:Vmn2r102 UTSW 17 19660583 missense probably benign 0.00
R4515:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4517:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4534:Vmn2r102 UTSW 17 19694713 missense probably benign
R4535:Vmn2r102 UTSW 17 19694713 missense probably benign
R4662:Vmn2r102 UTSW 17 19681162 missense probably damaging 1.00
R4708:Vmn2r102 UTSW 17 19694314 missense probably benign 0.00
R4734:Vmn2r102 UTSW 17 19677533 missense probably damaging 1.00
R4834:Vmn2r102 UTSW 17 19677941 missense probably damaging 0.99
R4927:Vmn2r102 UTSW 17 19660399 start codon destroyed probably benign 0.00
R5077:Vmn2r102 UTSW 17 19677572 missense probably benign 0.20
R5181:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R5277:Vmn2r102 UTSW 17 19694131 missense possibly damaging 0.49
R5418:Vmn2r102 UTSW 17 19694153 missense probably damaging 1.00
R5810:Vmn2r102 UTSW 17 19677542 missense probably benign 0.20
R5864:Vmn2r102 UTSW 17 19694681 missense possibly damaging 0.55
R6168:Vmn2r102 UTSW 17 19694140 missense possibly damaging 0.83
R6266:Vmn2r102 UTSW 17 19678745 missense probably benign
R6432:Vmn2r102 UTSW 17 19681221 missense possibly damaging 0.61
R6487:Vmn2r102 UTSW 17 19677907 missense probably damaging 1.00
R6597:Vmn2r102 UTSW 17 19694188 missense probably damaging 0.99
R6797:Vmn2r102 UTSW 17 19660432 nonsense probably null
R7009:Vmn2r102 UTSW 17 19694194 missense probably damaging 0.99
R7098:Vmn2r102 UTSW 17 19694408 missense probably damaging 1.00
R7134:Vmn2r102 UTSW 17 19677487 missense probably benign 0.01
R7463:Vmn2r102 UTSW 17 19676624 missense probably damaging 1.00
R7511:Vmn2r102 UTSW 17 19681143 missense probably damaging 1.00
R7512:Vmn2r102 UTSW 17 19694101 missense probably damaging 1.00
R7556:Vmn2r102 UTSW 17 19677831 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTTGTGAAACACCGAGACACTCC -3'
(R):5'- TGCTGTGCTGGAAGCCAAGATAG -3'

Sequencing Primer
(F):5'- GCCAAAGCTATTACTGTGGTC -3'
(R):5'- AGCCAAGATAGAGAATACTTCCATAG -3'
Posted On2013-05-23