Incidental Mutation 'R5125:Grin1'
ID393481
Institutional Source Beutler Lab
Gene Symbol Grin1
Ensembl Gene ENSMUSG00000026959
Gene Nameglutamate receptor, ionotropic, NMDA1 (zeta 1)
SynonymsRgsc174, M100174, NR1, GluRzeta1, NMDAR1, Nmdar
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5125 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25291181-25319187 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 25296827 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028335] [ENSMUST00000114307] [ENSMUST00000114308] [ENSMUST00000114310] [ENSMUST00000114312] [ENSMUST00000114314] [ENSMUST00000114317] [ENSMUST00000114318]
Predicted Effect probably benign
Transcript: ENSMUST00000028335
SMART Domains Protein: ENSMUSP00000028335
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 6.6e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.5e-18 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114307
SMART Domains Protein: ENSMUSP00000109946
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114308
SMART Domains Protein: ENSMUSP00000109947
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114310
SMART Domains Protein: ENSMUSP00000109949
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 39 299 3.6e-24 PFAM
Blast:PBPe 352 420 9e-37 BLAST
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 8.4e-17 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114312
SMART Domains Protein: ENSMUSP00000109951
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 5.9e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114314
SMART Domains Protein: ENSMUSP00000109953
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1.1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.3e-19 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114317
SMART Domains Protein: ENSMUSP00000109956
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 7.7e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114318
SMART Domains Protein: ENSMUSP00000109957
Gene: ENSMUSG00000026959

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8.4e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.4e-19 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135426
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a critical subunit of N-methyl-D-aspartate receptors, members of the glutamate receptor channel superfamily which are heteromeric protein complexes with multiple subunits arranged to form a ligand-gated ion channel. These subunits play a key role in the plasticity of synapses, which is believed to underlie memory and learning. Cell-specific factors are thought to control expression of different isoforms, possibly contributing to the functional diversity of the subunits. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutants lack whisker patterns in brain cortex, are ataxic and die neonatally of respiratory failure. Hypomorph mutants exhibit hyperactivity, stereotypy, and impaired social/sexual interactions. Mice homozygous for an ENU-induced allele exhibit abnormal behavior and neuron physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Ei24 T A 9: 36,782,446 probably benign Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Grin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Grin1 APN 2 25296967 missense possibly damaging 0.93
IGL01627:Grin1 APN 2 25318697 missense probably damaging 1.00
IGL02039:Grin1 APN 2 25305342 missense probably damaging 0.98
IGL02074:Grin1 APN 2 25298502 missense possibly damaging 0.81
IGL02083:Grin1 APN 2 25298501 missense possibly damaging 0.93
IGL03334:Grin1 APN 2 25298393 critical splice donor site probably null
IGL03349:Grin1 APN 2 25310436 missense probably benign
PIT4283001:Grin1 UTSW 2 25297852 missense probably damaging 1.00
R0038:Grin1 UTSW 2 25297459 missense probably null 0.82
R0829:Grin1 UTSW 2 25298448 missense probably benign 0.08
R1454:Grin1 UTSW 2 25292430 nonsense probably null
R1550:Grin1 UTSW 2 25305131 missense probably benign 0.01
R1969:Grin1 UTSW 2 25297915 missense probably benign 0.01
R2057:Grin1 UTSW 2 25316820 missense probably damaging 1.00
R2424:Grin1 UTSW 2 25318652 missense probably null 1.00
R2877:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R2878:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R3420:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3422:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3958:Grin1 UTSW 2 25313453 missense probably damaging 1.00
R4222:Grin1 UTSW 2 25297320 intron probably benign
R4224:Grin1 UTSW 2 25297320 intron probably benign
R4225:Grin1 UTSW 2 25297320 intron probably benign
R4409:Grin1 UTSW 2 25310439 missense possibly damaging 0.75
R4723:Grin1 UTSW 2 25294470 missense probably benign 0.30
R4775:Grin1 UTSW 2 25292463 missense possibly damaging 0.92
R4783:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4784:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4785:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4829:Grin1 UTSW 2 25318724 missense possibly damaging 0.47
R4915:Grin1 UTSW 2 25298553 intron probably benign
R5064:Grin1 UTSW 2 25303831 intron probably benign
R5103:Grin1 UTSW 2 25310421 missense probably benign
R5215:Grin1 UTSW 2 25303907 missense probably benign 0.00
R5419:Grin1 UTSW 2 25298273 synonymous probably null
R6119:Grin1 UTSW 2 25305158 missense probably damaging 1.00
R6616:Grin1 UTSW 2 25292110 missense possibly damaging 0.82
R6894:Grin1 UTSW 2 25295817 missense probably damaging 1.00
R7101:Grin1 UTSW 2 25296635 missense probably damaging 0.98
R7137:Grin1 UTSW 2 25313538 missense probably benign
X0026:Grin1 UTSW 2 25305098 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGATCGCACTTCTGTGAAGCC -3'
(R):5'- TGTCCCTGCAGCTCAGAAAC -3'

Sequencing Primer
(F):5'- TTCTGTGAAGCCTCAAACTCCAG -3'
(R):5'- CTCAGACAAGTTCATCTATGCAACTG -3'
Posted On2016-06-15