Incidental Mutation 'R5685:Zfp638'
ID443277
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Namezinc finger protein 638
SynonymsNp220, Zfml
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83867109-83989550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83929987 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 378 (P378H)
Ref Sequence ENSEMBL: ENSMUSP00000144989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203273] [ENSMUST00000203324] [ENSMUST00000203455] [ENSMUST00000203891] [ENSMUST00000204202] [ENSMUST00000204415] [ENSMUST00000204751]
Predicted Effect probably damaging
Transcript: ENSMUST00000032088
AA Change: P378H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016
AA Change: P378H

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113835
AA Change: P378H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016
AA Change: P378H

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113836
AA Change: P378H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016
AA Change: P378H

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203273
Predicted Effect probably damaging
Transcript: ENSMUST00000203324
AA Change: P378H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016
AA Change: P378H

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203455
AA Change: P378H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145047
Gene: ENSMUSG00000030016
AA Change: P378H

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
internal_repeat_1 819 891 3.29e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203808
Predicted Effect probably damaging
Transcript: ENSMUST00000203891
AA Change: P378H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016
AA Change: P378H

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204110
Predicted Effect probably damaging
Transcript: ENSMUST00000204202
AA Change: P378H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145170
Gene: ENSMUSG00000030016
AA Change: P378H

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204415
SMART Domains Protein: ENSMUSP00000145513
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 112 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204580
Predicted Effect probably damaging
Transcript: ENSMUST00000204751
AA Change: P378H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016
AA Change: P378H

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cfap57 G T 4: 118,569,459 Q1098K probably benign Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83979718 missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83956698 missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83977130 missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83929164 missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83934994 missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83944798 missense probably benign 0.01
IGL01570:Zfp638 APN 6 83947847 missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83979526 missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83984875 missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83969232 missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83984884 missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83935018 splice site probably benign
IGL03135:Zfp638 APN 6 83942875 missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83946247 missense probably benign 0.04
R0190:Zfp638 UTSW 6 83928964 missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83967354 missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83972238 unclassified probably benign
R0938:Zfp638 UTSW 6 83984041 missense probably benign 0.16
R1312:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83944656 missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83978065 intron probably null
R1634:Zfp638 UTSW 6 83979912 splice site probably null
R1651:Zfp638 UTSW 6 83954737 missense probably benign 0.00
R2079:Zfp638 UTSW 6 83953389 critical splice donor site probably null
R2134:Zfp638 UTSW 6 83928982 missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83986596 missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83929518 missense probably damaging 1.00
R2422:Zfp638 UTSW 6 83966439 splice site probably benign
R4353:Zfp638 UTSW 6 83984059 missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83981737 missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83979562 nonsense probably null
R4807:Zfp638 UTSW 6 83943058 missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83979475 missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83929456 missense probably benign 0.03
R5236:Zfp638 UTSW 6 83976575 nonsense probably null
R5323:Zfp638 UTSW 6 83962094 missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83976414 missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83967363 missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83979188 missense probably damaging 1.00
R5614:Zfp638 UTSW 6 83929641 missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83943129 missense probably damaging 0.97
R5689:Zfp638 UTSW 6 83929072 missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83944847 missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83977065 missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83867230 missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83965578 missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83930110 missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83953126 missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83954726 missense probably benign 0.00
R7141:Zfp638 UTSW 6 83867199 missense unknown
R7368:Zfp638 UTSW 6 83929455 missense possibly damaging 0.60
R7402:Zfp638 UTSW 6 83928688 missense possibly damaging 0.92
R7455:Zfp638 UTSW 6 83930145 missense probably damaging 1.00
Z1088:Zfp638 UTSW 6 83944811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCCAGACAACGAGCCAG -3'
(R):5'- GCACTGAGCATCATTGTACAGC -3'

Sequencing Primer
(F):5'- GACAACGAGCCAGTCTCTG -3'
(R):5'- TCACCTTCAAATGACTACATTCTACG -3'
Posted On2016-11-09