Incidental Mutation 'R5614:Zfp638'
ID438139
Institutional Source Beutler Lab
Gene Symbol Zfp638
Ensembl Gene ENSMUSG00000030016
Gene Namezinc finger protein 638
SynonymsNp220, Zfml
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83867109-83989550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83929641 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 263 (F263L)
Ref Sequence ENSEMBL: ENSMUSP00000144989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032088] [ENSMUST00000113835] [ENSMUST00000113836] [ENSMUST00000203273] [ENSMUST00000203324] [ENSMUST00000203455] [ENSMUST00000203891] [ENSMUST00000204202] [ENSMUST00000204415] [ENSMUST00000204751]
Predicted Effect probably damaging
Transcript: ENSMUST00000032088
AA Change: F263L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032088
Gene: ENSMUSG00000030016
AA Change: F263L

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113835
AA Change: F263L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109466
Gene: ENSMUSG00000030016
AA Change: F263L

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 880 949 9.04e-3 SMART
Blast:RRM_2 984 1052 2e-25 BLAST
low complexity region 1095 1109 N/A INTRINSIC
ZnF_U1 1218 1252 2.84e-8 SMART
ZnF_C2H2 1221 1245 2.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113836
AA Change: F263L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109467
Gene: ENSMUSG00000030016
AA Change: F263L

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1222 1256 2.84e-8 SMART
ZnF_C2H2 1225 1249 2.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203273
Predicted Effect probably damaging
Transcript: ENSMUST00000203324
AA Change: F263L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145124
Gene: ENSMUSG00000030016
AA Change: F263L

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1220 1254 1.7e-10 SMART
ZnF_C2H2 1223 1247 8.9e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203455
AA Change: F263L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145047
Gene: ENSMUSG00000030016
AA Change: F263L

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
internal_repeat_1 819 891 3.29e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203808
Predicted Effect probably damaging
Transcript: ENSMUST00000203891
AA Change: F263L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144939
Gene: ENSMUSG00000030016
AA Change: F263L

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 3.5e-2 SMART
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 3.9e-5 SMART
Blast:RRM_2 1007 1075 2e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
ZnF_U1 1186 1220 1.7e-10 SMART
ZnF_C2H2 1189 1213 8.9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204110
Predicted Effect probably damaging
Transcript: ENSMUST00000204202
AA Change: F263L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145170
Gene: ENSMUSG00000030016
AA Change: F263L

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_C2H2 424 448 5.9e-2 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 9.1e-9 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204415
SMART Domains Protein: ENSMUSP00000145513
Gene: ENSMUSG00000030016

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 112 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204580
Predicted Effect probably damaging
Transcript: ENSMUST00000204751
AA Change: F263L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144989
Gene: ENSMUSG00000030016
AA Change: F263L

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
ZnF_U1 421 455 5.93e0 SMART
ZnF_C2H2 424 448 1.36e1 SMART
low complexity region 482 523 N/A INTRINSIC
low complexity region 531 555 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
RRM 677 747 2.04e-6 SMART
low complexity region 749 763 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
RRM 903 972 9.04e-3 SMART
Blast:RRM_2 1007 1075 4e-25 BLAST
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1399 1412 N/A INTRINSIC
low complexity region 1512 1526 N/A INTRINSIC
low complexity region 1761 1771 N/A INTRINSIC
ZnF_U1 1873 1907 2.84e-8 SMART
ZnF_C2H2 1876 1900 2.14e0 SMART
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleoplasmic protein. It binds cytidine-rich sequences in double-stranded DNA. This protein has three types of domains: MH1, MH2 (repeated three times) and MH3. It is associated with packaging, transferring, or processing transcripts. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Zfp638
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Zfp638 APN 6 83979718 missense probably damaging 1.00
IGL00514:Zfp638 APN 6 83956698 missense probably damaging 1.00
IGL00705:Zfp638 APN 6 83977130 missense probably damaging 1.00
IGL00785:Zfp638 APN 6 83929164 missense probably damaging 1.00
IGL01068:Zfp638 APN 6 83934994 missense probably damaging 1.00
IGL01084:Zfp638 APN 6 83944798 missense probably benign 0.01
IGL01570:Zfp638 APN 6 83947847 missense probably damaging 1.00
IGL01758:Zfp638 APN 6 83979526 missense probably damaging 0.96
IGL02345:Zfp638 APN 6 83984875 missense probably damaging 1.00
IGL02939:Zfp638 APN 6 83969232 missense probably damaging 0.98
IGL03007:Zfp638 APN 6 83984884 missense probably damaging 1.00
IGL03118:Zfp638 APN 6 83935018 splice site probably benign
IGL03135:Zfp638 APN 6 83942875 missense probably damaging 1.00
IGL03264:Zfp638 APN 6 83946247 missense probably benign 0.04
R0190:Zfp638 UTSW 6 83928964 missense probably damaging 1.00
R0200:Zfp638 UTSW 6 83967354 missense probably damaging 1.00
R0766:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R0801:Zfp638 UTSW 6 83972238 unclassified probably benign
R0938:Zfp638 UTSW 6 83984041 missense probably benign 0.16
R1312:Zfp638 UTSW 6 83929041 missense probably damaging 1.00
R1458:Zfp638 UTSW 6 83944656 missense probably damaging 1.00
R1584:Zfp638 UTSW 6 83978065 intron probably null
R1634:Zfp638 UTSW 6 83979912 splice site probably null
R1651:Zfp638 UTSW 6 83954737 missense probably benign 0.00
R2079:Zfp638 UTSW 6 83953389 critical splice donor site probably null
R2134:Zfp638 UTSW 6 83928982 missense probably damaging 1.00
R2142:Zfp638 UTSW 6 83986596 missense probably damaging 1.00
R2201:Zfp638 UTSW 6 83929518 missense probably damaging 1.00
R2422:Zfp638 UTSW 6 83966439 splice site probably benign
R4353:Zfp638 UTSW 6 83984059 missense probably damaging 0.97
R4681:Zfp638 UTSW 6 83981737 missense possibly damaging 0.50
R4716:Zfp638 UTSW 6 83979562 nonsense probably null
R4807:Zfp638 UTSW 6 83943058 missense probably damaging 1.00
R4850:Zfp638 UTSW 6 83979475 missense possibly damaging 0.92
R5079:Zfp638 UTSW 6 83929456 missense probably benign 0.03
R5236:Zfp638 UTSW 6 83976575 nonsense probably null
R5323:Zfp638 UTSW 6 83962094 missense probably damaging 0.96
R5426:Zfp638 UTSW 6 83976414 missense probably damaging 1.00
R5557:Zfp638 UTSW 6 83967363 missense probably damaging 1.00
R5570:Zfp638 UTSW 6 83979188 missense probably damaging 1.00
R5662:Zfp638 UTSW 6 83943129 missense probably damaging 0.97
R5685:Zfp638 UTSW 6 83929987 missense probably damaging 1.00
R5689:Zfp638 UTSW 6 83929072 missense probably damaging 1.00
R5783:Zfp638 UTSW 6 83944847 missense possibly damaging 0.92
R5856:Zfp638 UTSW 6 83977065 missense probably damaging 1.00
R6310:Zfp638 UTSW 6 83867230 missense possibly damaging 0.90
R6477:Zfp638 UTSW 6 83965578 missense probably damaging 1.00
R6557:Zfp638 UTSW 6 83930110 missense probably damaging 1.00
R7084:Zfp638 UTSW 6 83953126 missense possibly damaging 0.50
R7101:Zfp638 UTSW 6 83954726 missense probably benign 0.00
R7141:Zfp638 UTSW 6 83867199 missense unknown
Z1088:Zfp638 UTSW 6 83944811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGCCGATTACCTAATTTAC -3'
(R):5'- GCTCGTTGTCTGGCTAACTG -3'

Sequencing Primer
(F):5'- TTACCTTCTCACAGCAGAAATAAGG -3'
(R):5'- CTGGCTAACTGTTTGGCTAATAGAC -3'
Posted On2016-10-26