Incidental Mutation 'R5685:Cfap57'
ID443272
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Namecilia and flagella associated protein 57
SynonymsWdr65, 1110020C03Rik, C130004B06Rik, LOC384050
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5685 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118554551-118620777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118569459 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1098 (Q1098K)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
Predicted Effect probably benign
Transcript: ENSMUST00000071972
AA Change: Q1098K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: Q1098K

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
AA Change: Q1098K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: Q1098K

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,230,550 probably benign Het
4921501E09Rik T A 17: 33,066,772 H352L probably benign Het
Abcb5 A T 12: 118,932,613 probably null Het
Abcg1 G T 17: 31,098,286 E191* probably null Het
Als2 A G 1: 59,179,091 Y1263H possibly damaging Het
Amer2 T A 14: 60,379,577 L281* probably null Het
Anxa6 T C 11: 54,996,370 N361D probably benign Het
Ap1g1 A T 8: 109,837,783 N320I probably damaging Het
Aqr T C 2: 114,156,265 D208G possibly damaging Het
Arnt2 T C 7: 84,263,265 T545A probably benign Het
Aspm G A 1: 139,487,288 V2701I probably benign Het
Atad2 A G 15: 58,116,798 V106A possibly damaging Het
Bbs2 A C 8: 94,087,433 F186V probably damaging Het
Catsperg2 G A 7: 29,701,188 P247L probably damaging Het
Cxcr6 A G 9: 123,810,746 T271A probably benign Het
Dock1 A G 7: 134,772,362 E579G probably benign Het
Frem3 A G 8: 80,695,303 T2111A probably damaging Het
Galnt1 A T 18: 24,264,529 D229V possibly damaging Het
Gbp2b A C 3: 142,608,158 M400L probably benign Het
Gm1123 T A 9: 99,009,433 probably null Het
Gtpbp6 T C 5: 110,104,939 H349R probably damaging Het
Hyal5 A G 6: 24,876,692 K188R probably benign Het
Insrr T C 3: 87,800,496 probably null Het
Kcnn1 A T 8: 70,852,730 C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,881,617 probably null Het
Kif23 T C 9: 61,945,409 T8A probably benign Het
Lrrk2 A T 15: 91,803,301 R2198* probably null Het
Mcl1 T G 3: 95,659,798 D177E possibly damaging Het
Mrps11 A T 7: 78,791,880 T137S probably benign Het
Mtbp A G 15: 55,562,772 Y90C probably damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nxt1 G T 2: 148,675,753 W138L possibly damaging Het
Olfr1042 T C 2: 86,159,795 T192A probably damaging Het
Olfr1102 T A 2: 87,002,277 S103T probably benign Het
Olfr183 T A 16: 59,000,346 F220L probably benign Het
Osbpl7 C A 11: 97,060,277 P478H probably damaging Het
Pitpna T A 11: 75,620,269 F222I probably damaging Het
Plekhh2 A T 17: 84,569,882 R552W probably damaging Het
Plxnb2 C T 15: 89,167,032 R328H probably damaging Het
Pmaip1 C T 18: 66,460,984 T65I probably benign Het
Ppil4 T G 10: 7,798,422 I110S probably damaging Het
Prpf38a A G 4: 108,570,154 probably null Het
Psme4 G A 11: 30,809,837 G320D probably damaging Het
Rab17 C A 1: 90,958,957 R191L probably benign Het
Rhag A T 17: 40,831,331 M222L possibly damaging Het
Rims2 A T 15: 39,437,206 H111L possibly damaging Het
Setx T C 2: 29,171,280 Y2234H probably damaging Het
Slc2a8 T C 2: 32,981,789 I51V possibly damaging Het
Slc34a1 T C 13: 55,401,272 probably null Het
Slf1 T C 13: 77,083,479 T594A possibly damaging Het
Sox6 A T 7: 115,579,157 probably null Het
Spata13 C T 14: 60,691,203 S70L probably benign Het
Stard13 A G 5: 151,063,127 I188T possibly damaging Het
Stard9 A G 2: 120,705,322 D4020G probably damaging Het
Tdp1 A G 12: 99,902,352 K255R possibly damaging Het
Tns2 G T 15: 102,107,103 A124S probably benign Het
Top2b T A 14: 16,413,666 W1045R probably damaging Het
Trav12-2 T C 14: 53,616,665 V32A probably damaging Het
Vps13c G T 9: 67,963,173 R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp52 T A 17: 21,561,751 S620R probably benign Het
Zfp62 T A 11: 49,216,217 C378* probably null Het
Zfp638 C A 6: 83,929,987 P378H probably damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense not run
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense not run
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense not run
R7412:Cfap57 UTSW 4 118614931 missense not run
R7414:Cfap57 UTSW 4 118614931 missense not run
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense not run
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGACAGCCAGGATGAGCTACTG -3'
(R):5'- AGATCCGTGGCCTCTTTGAG -3'

Sequencing Primer
(F):5'- CATGAGAAAGCTGTGGGTCCC -3'
(R):5'- CCTCTTTGAGAAGTACGTGCAGC -3'
Posted On2016-11-09