Incidental Mutation 'R5911:Grik4'
ID461005
Institutional Source Beutler Lab
Gene Symbol Grik4
Ensembl Gene ENSMUSG00000032017
Gene Nameglutamate receptor, ionotropic, kainate 4
Synonyms6330551K01Rik, GluRgamma1, KA-1, KA1
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42518135-42944493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42591424 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 468 (V468F)
Ref Sequence ENSEMBL: ENSMUSP00000110515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034515] [ENSMUST00000114865]
Predicted Effect probably damaging
Transcript: ENSMUST00000034515
AA Change: V468F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034515
Gene: ENSMUSG00000032017
AA Change: V468F

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 2.7e-60 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114865
AA Change: V468F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110515
Gene: ENSMUSG00000032017
AA Change: V468F

DomainStartEndE-ValueType
Pfam:ANF_receptor 41 382 5.1e-66 PFAM
PBPe 417 786 1.88e-132 SMART
Lig_chan-Glu_bd 427 491 5.91e-31 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
Meta Mutation Damage Score 0.406 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced GYKI-resistant excitatory postsynaptic current. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Grik4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Grik4 APN 9 42521176 missense probably damaging 0.99
IGL01929:Grik4 APN 9 42566298 critical splice donor site probably null
IGL02049:Grik4 APN 9 42543753 splice site probably benign
IGL02331:Grik4 APN 9 42541988 missense probably damaging 1.00
IGL02652:Grik4 APN 9 42675277 missense possibly damaging 0.94
IGL02817:Grik4 APN 9 42622939 missense probably benign 0.00
IGL02945:Grik4 APN 9 42597879 missense possibly damaging 0.92
IGL03100:Grik4 APN 9 42550455 missense probably damaging 0.99
IGL03168:Grik4 APN 9 42671243 missense probably damaging 1.00
R0420:Grik4 UTSW 9 42622096 nonsense probably null
R0894:Grik4 UTSW 9 42688109 splice site probably benign
R1458:Grik4 UTSW 9 42521122 missense probably benign 0.21
R1502:Grik4 UTSW 9 42520873 missense probably damaging 0.97
R1502:Grik4 UTSW 9 42591447 missense probably benign 0.03
R1808:Grik4 UTSW 9 42629026 missense probably benign 0.19
R1945:Grik4 UTSW 9 42521004 missense possibly damaging 0.79
R2180:Grik4 UTSW 9 42542005 missense probably benign 0.45
R2203:Grik4 UTSW 9 42547655 missense probably damaging 1.00
R2336:Grik4 UTSW 9 42566355 missense probably damaging 1.00
R2508:Grik4 UTSW 9 42622142 missense probably damaging 1.00
R2890:Grik4 UTSW 9 42671219 missense probably damaging 1.00
R3702:Grik4 UTSW 9 42675218 missense probably damaging 0.97
R3834:Grik4 UTSW 9 42629123 missense probably benign 0.04
R4082:Grik4 UTSW 9 42597884 missense probably benign 0.00
R4604:Grik4 UTSW 9 42524586 missense probably damaging 1.00
R4711:Grik4 UTSW 9 42629093 missense probably damaging 1.00
R5417:Grik4 UTSW 9 42671248 missense probably benign 0.45
R5540:Grik4 UTSW 9 42520947 missense probably damaging 0.99
R5680:Grik4 UTSW 9 42629119 missense probably benign
R5740:Grik4 UTSW 9 42808567 missense possibly damaging 0.88
R5876:Grik4 UTSW 9 42688023 missense probably damaging 1.00
R6319:Grik4 UTSW 9 42566336 missense probably damaging 1.00
R6475:Grik4 UTSW 9 42629008 missense probably benign 0.01
R6544:Grik4 UTSW 9 42547728 nonsense probably null
R7065:Grik4 UTSW 9 42543831 missense probably damaging 1.00
X0028:Grik4 UTSW 9 42675227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCACTAAAGATTTCTGGGATGG -3'
(R):5'- CATCCCACATGGCTGCAATG -3'

Sequencing Primer
(F):5'- CACTAAAGATTTCTGGGATGGATAGG -3'
(R):5'- CTGCAATGCCAGGGCTAAG -3'
Posted On2017-02-28