Incidental Mutation 'R5911:Hectd1'
ID461015
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene NameHECT domain E3 ubiquitin protein ligase 1
Synonymsb2b327Clo, opm, A630086P08Rik
MMRRC Submission 044108-MU
Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51743722-51829536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51802252 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 356 (D356E)
Ref Sequence ENSEMBL: ENSMUSP00000046766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]
Predicted Effect probably damaging
Transcript: ENSMUST00000042052
AA Change: D356E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: D356E

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179265
AA Change: D356E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: D356E

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51769108 missense possibly damaging 0.94
IGL00402:Hectd1 APN 12 51759432 missense probably benign
IGL00419:Hectd1 APN 12 51764035 missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51776489 splice site probably benign
IGL00565:Hectd1 APN 12 51790398 missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51774004 missense probably benign 0.17
IGL00576:Hectd1 APN 12 51759309 missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51748788 missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51791390 missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51761121 missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51802274 missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51803779 missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51802810 missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51782554 missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51794497 nonsense probably null
IGL01994:Hectd1 APN 12 51797942 missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51774137 missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51769191 missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51754133 splice site probably benign
IGL02177:Hectd1 APN 12 51772320 missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51797852 missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51800713 critical splice donor site probably null
IGL02519:Hectd1 APN 12 51769111 missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51762450 missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51764081 missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51767640 missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51790613 missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51768887 missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51744767 missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51827422 missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51769174 missense probably benign 0.00
IGL03078:Hectd1 APN 12 51802236 missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51800888 splice site probably benign
3-1:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51753825 missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51769107 missense probably damaging 0.99
R0268:Hectd1 UTSW 12 51769108 missense possibly damaging 0.94
R0409:Hectd1 UTSW 12 51782556 missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51748657 missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51761072 missense probably benign 0.11
R1087:Hectd1 UTSW 12 51776572 missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51764164 splice site probably benign
R1350:Hectd1 UTSW 12 51762434 missense probably benign
R1553:Hectd1 UTSW 12 51773878 missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51753824 missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51744788 missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51744592 missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51744794 missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51806567 missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51800955 missense probably benign 0.00
R1982:Hectd1 UTSW 12 51785841 missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51757116 splice site probably null
R2061:Hectd1 UTSW 12 51794444 missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51748542 missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51745494 missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51806462 missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51806471 missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51769008 missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51745534 missense probably benign 0.01
R3876:Hectd1 UTSW 12 51768730 missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51802436 critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51774750 missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51768723 nonsense probably null
R4116:Hectd1 UTSW 12 51768723 nonsense probably null
R4169:Hectd1 UTSW 12 51790225 missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51752052 missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51790493 missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51751932 missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51744573 missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51787912 missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R4883:Hectd1 UTSW 12 51784247 nonsense probably null
R4885:Hectd1 UTSW 12 51800722 missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51762497 missense probably benign 0.02
R4983:Hectd1 UTSW 12 51784262 missense probably benign 0.01
R5007:Hectd1 UTSW 12 51802660 missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51750388 missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51744879 missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51827489 start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51802533 critical splice donor site probably null
R5535:Hectd1 UTSW 12 51802326 missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51764114 missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51773835 missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51798754 missense probably damaging 0.98
R5919:Hectd1 UTSW 12 51769072 missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51754104 missense probably benign
R6141:Hectd1 UTSW 12 51746092 critical splice donor site probably null
R6172:Hectd1 UTSW 12 51769282 missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51748445 missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51744619 missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51794487 missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51764162 splice site probably null
R6971:Hectd1 UTSW 12 51748743 nonsense probably null
R7079:Hectd1 UTSW 12 51787855 missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R7171:Hectd1 UTSW 12 51759297 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACAAAGGCTGTCAACTAG -3'
(R):5'- GGTCAGAGCTTCCAGATTCAATCG -3'

Sequencing Primer
(F):5'- TGTAGAGCAGACTGCCCTTGAAC -3'
(R):5'- GAGCTTCCAGATTCAATCGAAAGTGC -3'
Posted On2017-02-28