Incidental Mutation 'R6129:Mkx'
ID487598
Institutional Source Beutler Lab
Gene Symbol Mkx
Ensembl Gene ENSMUSG00000061013
Gene Namemohawk homeobox
Synonyms9430023B20Rik, Irxl1
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location6910459-7004780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6992888 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 132 (V132A)
Ref Sequence ENSEMBL: ENSMUSP00000078718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079788]
Predicted Effect probably damaging
Transcript: ENSMUST00000079788
AA Change: V132A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078718
Gene: ENSMUSG00000061013
AA Change: V132A

DomainStartEndE-ValueType
HOX 71 135 5.01e-4 SMART
low complexity region 158 171 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188926
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an IRX family-related homeobox protein that may play a role in cell adhesion. Studies in mice suggest that this protein may be a regulator of tendon development. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thin, hypoplastic tendons with reduced tensile strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Mkx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Mkx APN 18 6937192 missense probably benign
IGL02478:Mkx APN 18 7002418 missense probably damaging 0.99
IGL02676:Mkx APN 18 7000640 missense probably benign 0.08
IGL02806:Mkx APN 18 6937025 missense probably damaging 1.00
R0766:Mkx UTSW 18 6937192 missense probably benign 0.05
R1273:Mkx UTSW 18 7002460 missense probably benign
R1312:Mkx UTSW 18 6937192 missense probably benign 0.05
R1496:Mkx UTSW 18 6992330 nonsense probably null
R2083:Mkx UTSW 18 6992855 missense probably damaging 0.99
R2196:Mkx UTSW 18 7000675 missense probably damaging 0.99
R3013:Mkx UTSW 18 6936929 missense probably damaging 0.99
R4544:Mkx UTSW 18 7000651 missense probably damaging 1.00
R4646:Mkx UTSW 18 6992040 missense probably benign 0.43
R4798:Mkx UTSW 18 7002432 missense probably benign
R4887:Mkx UTSW 18 6992904 missense probably damaging 1.00
R4945:Mkx UTSW 18 7000657 missense possibly damaging 0.76
R6267:Mkx UTSW 18 7000591 critical splice donor site probably null
R6271:Mkx UTSW 18 6937059 splice site probably null
R6296:Mkx UTSW 18 7000591 critical splice donor site probably null
R6569:Mkx UTSW 18 6992820 nonsense probably null
R7165:Mkx UTSW 18 7002525 missense probably damaging 0.97
R7365:Mkx UTSW 18 7000747 missense possibly damaging 0.85
Z1088:Mkx UTSW 18 6936975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTAGGGCGAACTTGTTG -3'
(R):5'- GTGTGGTACATTTACACAATGGAG -3'

Sequencing Primer
(F):5'- CCTAGGGCGAACTTGTTGCAAAAG -3'
(R):5'- GGAGCTCTTAAAAACAATGTCAGCTC -3'
Posted On2017-10-10