Incidental Mutation 'R6517:Zfp608'
ID520830
Institutional Source Beutler Lab
Gene Symbol Zfp608
Ensembl Gene ENSMUSG00000052713
Gene Namezinc finger protein 608
Synonyms4932417D18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location54888045-54990180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54899078 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 597 (C597S)
Ref Sequence ENSEMBL: ENSMUSP00000068192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064763]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064763
AA Change: C597S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068192
Gene: ENSMUSG00000052713
AA Change: C597S

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 459 471 N/A INTRINSIC
ZnF_C2H2 552 577 1.86e0 SMART
low complexity region 624 636 N/A INTRINSIC
low complexity region 706 718 N/A INTRINSIC
low complexity region 734 773 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 833 846 N/A INTRINSIC
low complexity region 934 956 N/A INTRINSIC
coiled coil region 1028 1054 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1255 1268 N/A INTRINSIC
low complexity region 1439 1450 N/A INTRINSIC
low complexity region 1458 1466 N/A INTRINSIC
low complexity region 1486 1502 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Zfp608
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Zfp608 APN 18 54988333 missense probably benign
IGL00920:Zfp608 APN 18 54889831 missense probably benign 0.00
IGL01088:Zfp608 APN 18 54898087 missense probably benign 0.03
IGL01447:Zfp608 APN 18 54899011 missense possibly damaging 0.75
IGL01534:Zfp608 APN 18 54898932 missense probably damaging 0.99
IGL01547:Zfp608 APN 18 54894449 critical splice donor site probably null
IGL01933:Zfp608 APN 18 54987799 missense probably benign
IGL01998:Zfp608 APN 18 54891818 missense probably damaging 0.99
IGL02167:Zfp608 APN 18 54988224 missense probably damaging 1.00
IGL02266:Zfp608 APN 18 54897581 missense probably benign 0.08
IGL02335:Zfp608 APN 18 54897437 nonsense probably null
IGL02455:Zfp608 APN 18 54899333 missense probably damaging 1.00
IGL02612:Zfp608 APN 18 54898201 missense probably damaging 1.00
IGL02900:Zfp608 APN 18 54946793 missense probably damaging 1.00
PIT4243001:Zfp608 UTSW 18 54898024 missense probably damaging 1.00
PIT4519001:Zfp608 UTSW 18 54946711 missense possibly damaging 0.71
R0005:Zfp608 UTSW 18 54895520 missense possibly damaging 0.88
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0010:Zfp608 UTSW 18 54895214 splice site probably benign
R0064:Zfp608 UTSW 18 54898816 missense probably benign
R0401:Zfp608 UTSW 18 54898994 missense probably benign
R0722:Zfp608 UTSW 18 54900234 missense probably damaging 1.00
R1351:Zfp608 UTSW 18 54898391 missense probably benign 0.00
R1512:Zfp608 UTSW 18 54946666 missense probably damaging 1.00
R1554:Zfp608 UTSW 18 54898054 missense probably damaging 1.00
R1622:Zfp608 UTSW 18 54988294 missense probably benign 0.07
R1669:Zfp608 UTSW 18 54987739 missense probably benign 0.09
R1690:Zfp608 UTSW 18 54987634 missense possibly damaging 0.62
R1721:Zfp608 UTSW 18 54899249 missense probably benign
R1826:Zfp608 UTSW 18 54898576 missense probably benign 0.03
R1864:Zfp608 UTSW 18 54897911 missense probably benign 0.00
R1952:Zfp608 UTSW 18 54897779 nonsense probably null
R2049:Zfp608 UTSW 18 54895565 missense probably damaging 1.00
R2051:Zfp608 UTSW 18 54988314 missense probably benign
R2168:Zfp608 UTSW 18 54898053 nonsense probably null
R2218:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R2283:Zfp608 UTSW 18 54988374 missense probably damaging 1.00
R2399:Zfp608 UTSW 18 54897902 missense probably damaging 1.00
R2520:Zfp608 UTSW 18 54988506 missense possibly damaging 0.92
R2961:Zfp608 UTSW 18 54898472 missense possibly damaging 0.60
R4074:Zfp608 UTSW 18 54898108 missense probably damaging 1.00
R4076:Zfp608 UTSW 18 54898108 missense probably damaging 1.00
R4206:Zfp608 UTSW 18 54988195 missense probably damaging 1.00
R4756:Zfp608 UTSW 18 54894472 missense probably damaging 1.00
R4771:Zfp608 UTSW 18 54988300 missense probably benign
R4820:Zfp608 UTSW 18 54987684 missense probably benign 0.14
R4825:Zfp608 UTSW 18 54897969 missense probably benign 0.01
R4912:Zfp608 UTSW 18 54946591 missense probably damaging 1.00
R4975:Zfp608 UTSW 18 54889890 missense probably damaging 1.00
R5138:Zfp608 UTSW 18 54891799 missense probably damaging 1.00
R5192:Zfp608 UTSW 18 54898497 missense probably damaging 1.00
R5557:Zfp608 UTSW 18 54987870 missense possibly damaging 0.81
R5624:Zfp608 UTSW 18 54898272 missense probably damaging 1.00
R5818:Zfp608 UTSW 18 54895396 missense probably benign 0.02
R5840:Zfp608 UTSW 18 54898906 missense probably damaging 1.00
R5992:Zfp608 UTSW 18 54899248 missense probably benign 0.15
R6106:Zfp608 UTSW 18 54987872 missense possibly damaging 0.54
R6174:Zfp608 UTSW 18 54988544 start gained probably benign
R6181:Zfp608 UTSW 18 54895628 missense possibly damaging 0.56
R6567:Zfp608 UTSW 18 54897556 missense probably damaging 1.00
R6668:Zfp608 UTSW 18 54898019 missense probably damaging 1.00
R6920:Zfp608 UTSW 18 54988265 missense probably damaging 1.00
R7061:Zfp608 UTSW 18 54987997 missense probably benign
R7074:Zfp608 UTSW 18 54897382 missense possibly damaging 0.69
R7087:Zfp608 UTSW 18 54899397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTCTTGCCAGTTTTCGAACC -3'
(R):5'- GCACGAATTCCAGAAGCACG -3'

Sequencing Primer
(F):5'- CTATAATAGGACCTGGGCCATTGC -3'
(R):5'- TCCTCAGGGGAAGCCAGAGAC -3'
Posted On2018-06-06