Incidental Mutation 'R6517:Myo1g'
ID520812
Institutional Source Beutler Lab
Gene Symbol Myo1g
Ensembl Gene ENSMUSG00000020437
Gene Namemyosin IG
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location6506548-6520965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6512509 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 541 (N541D)
Ref Sequence ENSEMBL: ENSMUSP00000003459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003459] [ENSMUST00000144725]
Predicted Effect probably damaging
Transcript: ENSMUST00000003459
AA Change: N541D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003459
Gene: ENSMUSG00000020437
AA Change: N541D

DomainStartEndE-ValueType
MYSc 9 714 N/A SMART
IQ 715 737 2.79e0 SMART
Pfam:Myosin_TH1 821 1024 2.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134639
Predicted Effect probably benign
Transcript: ENSMUST00000144725
SMART Domains Protein: ENSMUSP00000120975
Gene: ENSMUSG00000020437

DomainStartEndE-ValueType
Blast:MYSc 9 43 8e-14 BLAST
low complexity region 48 60 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156878
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYO1G is a plasma membrane-associated class I myosin (see MIM 601478) that is abundant in T and B lymphocytes and mast cells (Pierce et al., 2001 [PubMed 11544309]; Patino-Lopez et al., 2010 [PubMed 20071333]).[supplied by OMIM, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced B cell spreading, migration and homing and impaired T cell motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Myo1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Myo1g APN 11 6515856 missense possibly damaging 0.70
IGL01608:Myo1g APN 11 6516780 missense possibly damaging 0.61
IGL01679:Myo1g APN 11 6518006 missense possibly damaging 0.90
IGL01830:Myo1g APN 11 6514522 nonsense probably null
IGL02332:Myo1g APN 11 6520766 missense possibly damaging 0.61
IGL02813:Myo1g APN 11 6518743 makesense probably null
IGL02988:Myo1g APN 11 6508183 splice site probably benign
IGL03178:Myo1g APN 11 6512181 missense probably damaging 1.00
R0004:Myo1g UTSW 11 6515901 missense probably damaging 1.00
R0334:Myo1g UTSW 11 6511084 splice site probably benign
R0513:Myo1g UTSW 11 6510203 missense probably benign 0.00
R0730:Myo1g UTSW 11 6520794 missense probably damaging 1.00
R1054:Myo1g UTSW 11 6518987 missense probably damaging 1.00
R1434:Myo1g UTSW 11 6509372 missense probably benign 0.00
R1500:Myo1g UTSW 11 6520811 missense probably benign
R1513:Myo1g UTSW 11 6515140 missense probably damaging 0.99
R1720:Myo1g UTSW 11 6512490 missense probably benign 0.44
R1774:Myo1g UTSW 11 6515988 missense probably damaging 1.00
R1809:Myo1g UTSW 11 6512283 missense probably benign 0.02
R1957:Myo1g UTSW 11 6512159 critical splice donor site probably null
R1978:Myo1g UTSW 11 6520829 missense possibly damaging 0.53
R2212:Myo1g UTSW 11 6517870 missense possibly damaging 0.88
R2438:Myo1g UTSW 11 6511542 missense probably damaging 1.00
R2566:Myo1g UTSW 11 6512539 critical splice acceptor site probably null
R3158:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3159:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3413:Myo1g UTSW 11 6517870 missense possibly damaging 0.88
R3816:Myo1g UTSW 11 6510926 missense probably benign 0.02
R3872:Myo1g UTSW 11 6514886 missense possibly damaging 0.94
R3946:Myo1g UTSW 11 6520760 missense possibly damaging 0.89
R4551:Myo1g UTSW 11 6517874 missense probably damaging 1.00
R4625:Myo1g UTSW 11 6512240 missense probably damaging 1.00
R4630:Myo1g UTSW 11 6519047 missense probably damaging 1.00
R4700:Myo1g UTSW 11 6516785 unclassified probably null
R4713:Myo1g UTSW 11 6516080 missense probably null 1.00
R4964:Myo1g UTSW 11 6515976 missense probably damaging 1.00
R5183:Myo1g UTSW 11 6508243 missense probably damaging 1.00
R5191:Myo1g UTSW 11 6515105 missense probably benign
R5192:Myo1g UTSW 11 6514816 missense probably damaging 1.00
R5726:Myo1g UTSW 11 6509420 missense probably benign 0.06
R5841:Myo1g UTSW 11 6507000 missense probably benign 0.05
R5942:Myo1g UTSW 11 6514888 missense probably damaging 1.00
R6225:Myo1g UTSW 11 6519168 missense probably damaging 1.00
R6563:Myo1g UTSW 11 6517146 missense possibly damaging 0.91
R7214:Myo1g UTSW 11 6511055 missense probably damaging 1.00
R7258:Myo1g UTSW 11 6509416 missense possibly damaging 0.92
R7265:Myo1g UTSW 11 6510933 missense possibly damaging 0.92
X0017:Myo1g UTSW 11 6516077 critical splice donor site probably null
X0061:Myo1g UTSW 11 6517967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCATGGCAGGGCAAAGC -3'
(R):5'- CAGAGGGAAACTTATCCTGAGG -3'

Sequencing Primer
(F):5'- GCCCACCTGACCCAATATAG -3'
(R):5'- GGGAAACTTATCCTGAGGAGAAC -3'
Posted On2018-06-06