Incidental Mutation 'R0606:Eif5b'
ID54116
Institutional Source Beutler Lab
Gene Symbol Eif5b
Ensembl Gene ENSMUSG00000026083
Gene Nameeukaryotic translation initiation factor 5B
SynonymsA030003E17Rik, IF2
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0606 (G1)
Quality Score212
Status Validated
Chromosome1
Chromosomal Location37998010-38055579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38048893 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 990 (L990H)
Ref Sequence ENSEMBL: ENSMUSP00000027252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000027252]
Predicted Effect probably benign
Transcript: ENSMUST00000027251
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000027252
AA Change: L990H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: L990H

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195664
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Eif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Eif5b APN 1 38041719 missense probably damaging 1.00
IGL01377:Eif5b APN 1 38036098 missense probably benign
IGL01395:Eif5b APN 1 38037258 missense probably damaging 0.96
IGL01572:Eif5b APN 1 38022254 nonsense probably null
IGL01615:Eif5b APN 1 38045706 missense probably damaging 1.00
IGL02141:Eif5b APN 1 38032322 missense probably benign 0.09
IGL02260:Eif5b APN 1 38045456 missense possibly damaging 0.81
IGL02308:Eif5b APN 1 38041747 missense probably damaging 1.00
IGL03180:Eif5b APN 1 38036269 missense probably damaging 1.00
IGL03327:Eif5b APN 1 38041691 splice site probably benign
R0018:Eif5b UTSW 1 38018889 missense unknown
R0036:Eif5b UTSW 1 38019111 missense probably benign 0.23
R0137:Eif5b UTSW 1 38019243 missense probably benign 0.23
R0349:Eif5b UTSW 1 38032366 missense probably benign 0.18
R1056:Eif5b UTSW 1 38022167 missense unknown
R1225:Eif5b UTSW 1 38037628 missense probably damaging 1.00
R2043:Eif5b UTSW 1 38041819 missense probably damaging 1.00
R2163:Eif5b UTSW 1 38048794 missense probably benign 0.32
R2225:Eif5b UTSW 1 38019223 missense unknown
R2432:Eif5b UTSW 1 38019342 missense unknown
R2922:Eif5b UTSW 1 38018019 splice site probably benign
R4357:Eif5b UTSW 1 38050258 missense probably damaging 1.00
R4631:Eif5b UTSW 1 38041747 missense probably damaging 1.00
R4665:Eif5b UTSW 1 38045712 missense probably damaging 1.00
R4702:Eif5b UTSW 1 38018877 missense unknown
R4941:Eif5b UTSW 1 38051199 missense probably damaging 1.00
R4995:Eif5b UTSW 1 38051711 makesense probably null
R5020:Eif5b UTSW 1 38019069 nonsense probably null
R5175:Eif5b UTSW 1 38045387 missense probably damaging 1.00
R5375:Eif5b UTSW 1 38045754 missense possibly damaging 0.66
R5566:Eif5b UTSW 1 38045684 missense possibly damaging 0.90
R5566:Eif5b UTSW 1 38051247 missense probably damaging 1.00
R5853:Eif5b UTSW 1 38037307 missense probably damaging 1.00
R5978:Eif5b UTSW 1 37998280 unclassified probably null
R6315:Eif5b UTSW 1 38018033 missense unknown
R6376:Eif5b UTSW 1 38045679 missense probably damaging 0.98
R6388:Eif5b UTSW 1 38019000 missense unknown
R6444:Eif5b UTSW 1 38036211 missense probably damaging 1.00
R6455:Eif5b UTSW 1 38019027 missense probably benign 0.23
R6810:Eif5b UTSW 1 38046660 missense probably benign 0.45
R6877:Eif5b UTSW 1 38050239 missense probably damaging 1.00
R7130:Eif5b UTSW 1 38041776 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTGCTTGCTGTCAGGCATAC -3'
(R):5'- ACTGGGGATCATGTTCCAACATCAC -3'

Sequencing Primer
(F):5'- TATATTACCTCAGGCCGGAGAG -3'
(R):5'- GGATCATGTTCCAACATCACTGAAG -3'
Posted On2013-07-11