Incidental Mutation 'R7116:Pde1b'
ID551800
Institutional Source Beutler Lab
Gene Symbol Pde1b
Ensembl Gene ENSMUSG00000022489
Gene Namephosphodiesterase 1B, Ca2+-calmodulin dependent
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location103503034-103530052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103528318 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 534 (L534P)
Ref Sequence ENSEMBL: ENSMUSP00000023132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023132] [ENSMUST00000023133] [ENSMUST00000226468] [ENSMUST00000227955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023132
AA Change: L534P

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023132
Gene: ENSMUSG00000022489
AA Change: L534P

DomainStartEndE-ValueType
coiled coil region 38 60 N/A INTRINSIC
Pfam:PDEase_I_N 76 136 1.2e-33 PFAM
HDc 219 383 8.77e-5 SMART
Blast:HDc 394 443 1e-20 BLAST
low complexity region 467 478 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023133
SMART Domains Protein: ENSMUSP00000023133
Gene: ENSMUSG00000022490

DomainStartEndE-ValueType
Pfam:DARPP-32 2 165 2.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226468
Predicted Effect possibly damaging
Transcript: ENSMUST00000227955
AA Change: L515P

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE1 subfamily. Members of the PDE1 family are calmodulin-dependent PDEs that are stimulated by a calcium-calmodulin complex. This PDE has dual-specificity for the second messengers, cAMP and cGMP, with a preference for cGMP as a substrate. cAMP and cGMP function as key regulators of many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased exploratory behavior. Learning deficits and hyperactivity are also observed in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Pde1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pde1b APN 15 103526680 missense probably damaging 1.00
IGL01539:Pde1b APN 15 103525345 splice site probably benign
IGL01988:Pde1b APN 15 103524856 unclassified probably null
IGL02380:Pde1b APN 15 103519990 missense possibly damaging 0.80
IGL02424:Pde1b APN 15 103528219 splice site probably benign
IGL02710:Pde1b APN 15 103522057 missense probably damaging 1.00
R0111:Pde1b UTSW 15 103503513 missense probably benign
R1302:Pde1b UTSW 15 103527599 missense probably benign 0.12
R1312:Pde1b UTSW 15 103526273 missense possibly damaging 0.71
R1449:Pde1b UTSW 15 103525043 missense probably damaging 0.99
R1631:Pde1b UTSW 15 103521672 missense probably damaging 0.97
R1848:Pde1b UTSW 15 103525340 splice site probably null
R4032:Pde1b UTSW 15 103521326 missense probably damaging 1.00
R4896:Pde1b UTSW 15 103521374 missense probably damaging 1.00
R4901:Pde1b UTSW 15 103526685 missense probably null 0.92
R5052:Pde1b UTSW 15 103527648 missense possibly damaging 0.76
R5935:Pde1b UTSW 15 103521439 missense possibly damaging 0.81
R6117:Pde1b UTSW 15 103521482 missense probably damaging 0.99
R7092:Pde1b UTSW 15 103527031 missense probably benign 0.02
R7270:Pde1b UTSW 15 103521655 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGGTAGATGAGGGTCAGTCC -3'
(R):5'- TTCAAGAAAGGACTGTGGGACC -3'

Sequencing Primer
(F):5'- AGGGTCAGTCCTCTTATTTTCTTCAC -3'
(R):5'- AAGGTAGTAGGAGTCCCTTGC -3'
Posted On2019-05-15