Incidental Mutation 'R7116:Rsbn1'
ID551755
Institutional Source Beutler Lab
Gene Symbol Rsbn1
Ensembl Gene ENSMUSG00000044098
Gene Namerosbin, round spermatid basic protein 1
SynonymsC230004D03Rik, Rsbp
Accession Numbers

Genbank: NM_172684; MGI: 2444993

Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R7116 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103914120-103966636 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 103914576 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 3 (C3*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000051139] [ENSMUST00000068879] [ENSMUST00000146071]
Predicted Effect probably benign
Transcript: ENSMUST00000029433
SMART Domains Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 2e-65 BLAST
PDB:1JEG|B 605 629 2e-8 PDB
Predicted Effect probably null
Transcript: ENSMUST00000051139
AA Change: C42*
SMART Domains Protein: ENSMUSP00000058934
Gene: ENSMUSG00000044098
AA Change: C42*

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 466 477 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068879
AA Change: C42*
SMART Domains Protein: ENSMUSP00000069246
Gene: ENSMUSG00000044098
AA Change: C42*

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 131 156 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126548
Predicted Effect probably benign
Transcript: ENSMUST00000146071
SMART Domains Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 9e-66 BLAST
internal_repeat_1 567 629 1.92e-7 PROSPERO
internal_repeat_1 651 705 1.92e-7 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000151927
AA Change: C3*
SMART Domains Protein: ENSMUSP00000115693
Gene: ENSMUSG00000044098
AA Change: C3*

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
Meta Mutation Damage Score 0.608 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(9) : Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Rsbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rsbn1 APN 3 103928690 missense probably benign 0.01
IGL00725:Rsbn1 APN 3 103928821 missense probably damaging 0.96
IGL01682:Rsbn1 APN 3 103962380 missense probably benign 0.03
IGL01978:Rsbn1 APN 3 103961500 missense probably damaging 0.99
IGL02281:Rsbn1 APN 3 103962461 missense probably damaging 0.99
IGL02615:Rsbn1 APN 3 103953752 missense probably damaging 1.00
IGL02902:Rsbn1 APN 3 103953656 missense possibly damaging 0.62
IGL02903:Rsbn1 APN 3 103928569 missense probably damaging 1.00
IGL02927:Rsbn1 APN 3 103962352 missense probably benign
IGL03007:Rsbn1 APN 3 103928879 missense probably damaging 1.00
IGL03062:Rsbn1 APN 3 103953629 intron probably benign
IGL03345:Rsbn1 APN 3 103915150 missense possibly damaging 0.78
F2404:Rsbn1 UTSW 3 103914576 nonsense probably null
R0277:Rsbn1 UTSW 3 103914581 missense possibly damaging 0.66
R0815:Rsbn1 UTSW 3 103954153 missense probably damaging 0.98
R1760:Rsbn1 UTSW 3 103960031 missense probably damaging 1.00
R1801:Rsbn1 UTSW 3 103914872 missense probably damaging 0.97
R2021:Rsbn1 UTSW 3 103914473 missense probably benign
R2078:Rsbn1 UTSW 3 103961523 missense probably damaging 1.00
R2330:Rsbn1 UTSW 3 103914500 missense probably damaging 0.97
R3956:Rsbn1 UTSW 3 103928675 missense probably damaging 0.99
R4094:Rsbn1 UTSW 3 103928658 missense probably damaging 0.98
R4649:Rsbn1 UTSW 3 103953780 splice site probably null
R4720:Rsbn1 UTSW 3 103929020 missense possibly damaging 0.92
R5299:Rsbn1 UTSW 3 103914490 missense probably benign 0.01
R5505:Rsbn1 UTSW 3 103928943 missense probably damaging 1.00
R5699:Rsbn1 UTSW 3 103962485 missense probably benign 0.02
R5775:Rsbn1 UTSW 3 103962572 missense possibly damaging 0.80
R6509:Rsbn1 UTSW 3 103960032 missense probably damaging 1.00
R6629:Rsbn1 UTSW 3 103928441 missense probably damaging 1.00
R7070:Rsbn1 UTSW 3 103928983 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGAAGCTCGGTTGGCGAG -3'
(R):5'- TCCTTGTGCTTGAGATCGCC -3'

Sequencing Primer
(F):5'- AGGTCTGCGGAGAGGTGTC -3'
(R):5'- GCATTCGTTGGAGGCAGC -3'
Posted On2019-05-15