Incidental Mutation 'R0943:Agtpbp1'
ID81978
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene NameATP/GTP binding protein 1
Synonyms2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik
MMRRC Submission 039082-MU
Accession Numbers

Genbank: NM_023328; MGI: 2159437

Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R0943 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59445742-59585227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59500602 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 468 (N468S)
Ref Sequence ENSEMBL: ENSMUSP00000132697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000109830] [ENSMUST00000164215] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000171606]
Predicted Effect probably benign
Transcript: ENSMUST00000022040
AA Change: N468S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: N468S

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109830
AA Change: N468S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: N468S

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163149
AA Change: N355S
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: N355S

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164215
AA Change: N468S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: N468S

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect probably benign
Transcript: ENSMUST00000170555
AA Change: N468S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: N468S

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171606
AA Change: N468S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: N468S

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Meta Mutation Damage Score 0.008 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam72a T C 1: 131,528,779 S27P possibly damaging Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Hoxb13 A G 11: 96,195,973 E202G probably benign Het
Lcmt1 T G 7: 123,401,439 probably null Het
Mettl7a1 T C 15: 100,304,958 Y20H probably benign Het
Nars2 C T 7: 96,955,931 probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Spry2 T C 14: 105,893,587 Y55C probably damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tbrg4 A G 11: 6,619,008 F388L probably damaging Het
Tshz1 T C 18: 84,015,231 T351A probably benign Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Zswim2 T A 2: 83,917,998 R279S possibly damaging Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59450172 missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59462094 missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59504226 missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59508063 splice site probably benign
IGL01921:Agtpbp1 APN 13 59512483 missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59500461 missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59500489 missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59528419 missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59482601 missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59474589 missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59532080 splice site probably benign
IGL03218:Agtpbp1 APN 13 59500207 missense possibly damaging 0.94
drunk UTSW 13 59512323 critical splice donor site probably benign
gru UTSW 13 59473746 missense probably damaging 1.00
rio UTSW 13 59525241 critical splice acceptor site probably benign
wobble UTSW 13 59474550 missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59462031 missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59514152 missense probably benign 0.24
R0559:Agtpbp1 UTSW 13 59497000 missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59533939 intron probably benign
R1196:Agtpbp1 UTSW 13 59450318 unclassified probably benign
R1421:Agtpbp1 UTSW 13 59495575 missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59500634 synonymous probably null
R1833:Agtpbp1 UTSW 13 59465983 critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59450202 missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59475803 frame shift probably null
R2006:Agtpbp1 UTSW 13 59500321 missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59474569 missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59497015 missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59460596 missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59500407 missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59528399 missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59500072 missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59500572 missense probably benign
R4969:Agtpbp1 UTSW 13 59500578 missense probably benign
R5066:Agtpbp1 UTSW 13 59474550 missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59500213 missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59500639 missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59473743 missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59482580 missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59500515 missense probably benign
R5824:Agtpbp1 UTSW 13 59466099 missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59534046 nonsense probably null
R6109:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59450300 missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59500020 missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59477040 missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59544353 intron probably null
R6950:Agtpbp1 UTSW 13 59450266 missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59504294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTTCCCAAGATGTACCGTCC -3'
(R):5'- GCAGACATTCTGTTGTTGAGCTGCC -3'

Sequencing Primer
(F):5'- CTTGCGAAGGAACATTCTGC -3'
(R):5'- ttactgtgtatgagtgttttgcc -3'
Posted On2013-11-08