Incidental Mutation 'R1033:Hpse2'
ID95350
Institutional Source Beutler Lab
Gene Symbol Hpse2
Ensembl Gene ENSMUSG00000074852
Gene Nameheparanase 2
SynonymsLOC381226
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location42788947-43388311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42913199 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 368 (V368A)
Ref Sequence ENSEMBL: ENSMUSP00000097026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099428]
Predicted Effect probably benign
Transcript: ENSMUST00000099428
AA Change: V368A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097026
Gene: ENSMUSG00000074852
AA Change: V368A

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Glyco_hydro_79n 168 408 6.6e-22 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heparanase enzyme. The encoded protein is a endoglycosidase that degrades heparin sulfate proteoglycans located on the extracellular matrix and cell surface. This protein may be involved in biological processes involving remodeling of the extracellular matrix including angiogenesis and tumor progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit growth retardation, a distended urinary bladder, abnormal voiding behavior, proteinuria, renal dysfunction and malnutrition, reduced cell proliferation, urinary bladder fibrosis, and lethality within one month of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Atp2b2 A T 6: 113,793,888 probably null Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Hpse2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Hpse2 APN 19 43384789 missense probably benign
IGL02315:Hpse2 APN 19 42966947 splice site probably benign
IGL02324:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02328:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02388:Hpse2 APN 19 43294253 missense probably damaging 1.00
IGL02977:Hpse2 APN 19 42789122 splice site probably benign
R0147:Hpse2 UTSW 19 42931660 splice site probably null
R0148:Hpse2 UTSW 19 42931660 splice site probably null
R0472:Hpse2 UTSW 19 43013163 missense probably damaging 0.99
R0892:Hpse2 UTSW 19 43388146 missense probably benign 0.31
R1242:Hpse2 UTSW 19 42966977 missense probably benign 0.00
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R1611:Hpse2 UTSW 19 42789065 missense probably damaging 1.00
R2382:Hpse2 UTSW 19 42931622 missense probably benign 0.04
R2496:Hpse2 UTSW 19 43013043 critical splice donor site probably null
R2982:Hpse2 UTSW 19 43384743 missense probably null 0.99
R4056:Hpse2 UTSW 19 43294275 missense probably damaging 1.00
R4057:Hpse2 UTSW 19 43294275 missense probably damaging 1.00
R4434:Hpse2 UTSW 19 43294269 missense probably benign 0.00
R4762:Hpse2 UTSW 19 42789071 missense possibly damaging 0.52
R4856:Hpse2 UTSW 19 42788957 missense probably damaging 1.00
R4886:Hpse2 UTSW 19 43384764 missense probably damaging 1.00
R5018:Hpse2 UTSW 19 43384824 missense possibly damaging 0.57
R6289:Hpse2 UTSW 19 42788979 missense probably null 1.00
R6382:Hpse2 UTSW 19 43388202 missense possibly damaging 0.93
R6805:Hpse2 UTSW 19 43294321 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACTGGAAATGCTCTTTGCTTTGC -3'
(R):5'- AGAATCTGACACATGGGTCAGGGAC -3'

Sequencing Primer
(F):5'- AAATGCTCTTTGCTTTGCAATGG -3'
(R):5'- GTGTGGCAACTCACTCTAGC -3'
Posted On2014-01-05